RASSF1 (NM_007182) Human 3' UTR Clone

CAT#: SC210114

3`UTR clone of Ras association (RalGDS/AF-6) domain family member 1 (RASSF1) transcript variant A for miRNA target validation

Clone Modification / Custom Cloning Service

USD 526.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name RASSF1 (NM_007182) Human 3' UTR Clone
Vector pMirTarget
Symbol RASSF1
Synonyms 123F2; NORE2A; RASSF1A; RDA32; REH3P21
ACCN NM_007182
Insert Size 819
Sequence Data
Insert Sequence
>SC210114 3'UTR clone of NM_007182
The sequence shown below is from the reference sequence of NM_007182. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGCCAGAAGATCCAAGAGGCCCTGCACGCCTGCCCCCTTGGGTGACCTCTTGTACCCCCAGGTGGAAGGC
AGACAGCAGGCAGCGCCAAGTGCGTGCCGTGTGAGTGTGACAGGGCCAGTGGGGCCTGTGGAATGAGTGT
GCATGGAGGCCCTCCTGTGCTGGGGGAATGAGCCCAGAGAACAGCGAAGTAGCTTGCTCCCTGTGTCCAC
CTGTGGGTGTAGCCAGGTATGGCTCTGCACCCCTCTGCCCTCATTACTGGGCCTTAGTGGGCCAGGGCTG
CCCTGAGAAGCTGCTCCAGGCCTGCAGCAGGAGTGGTGCAGACAGAAGTCTCCTCAATTTTTGTCTCAGA
AGTGAAAATCTTGGAGACCCTGCAAACAGAACAGGGTCATGTTTGCAGGGGTGACGGCCCTCATCTATGA
GGAAAGGTTTTGGATCTTGAATGTGGTCTCAGGATATCCTTATCAGAGCTAAGGGTGGGTGCTCAGAATA
AGGCAGGCATTGAGGAAGAGTCTTGGTTTCTCTCTACAGTGCCAACTCCTCACACACCCTGAGGTCAGGG
AGTGCTGGCTCACAGTACAGCATGTGCCTTAATGCTTCATATGAGGAGGATGTCCCTGGGCCAGGGTCTG
TGTGAATGTGGGCACTGGCCCAGGTTCATACCTTATTTGCTAATCAAAGCCAGGGTCTCTCCCTCAGGTG
TTTTTTATGAAGTGCGTGAATGTATGTAATGTGTGGTGGCCTCAGCTGAATGCCTCCTGTGGGGAAAGGG
GTTGGGGTGACAGTCATCATCAGGGCCTGGGGCCTGAGAGAATTGGCTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_007182.4
Synonyms 123F2; NORE2A; RASSF1A; RDA32; REH3P21
Summary This gene encodes a protein similar to the RAS effector proteins. Loss or altered expression of this gene has been associated with the pathogenesis of a variety of cancers, which suggests the tumor suppressor function of this gene. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1, and thus induce cell cycle arrest. Several alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, May 2011].
Locus ID 11186
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations

Documents