KCNA5 (NM_002234) Human 3' UTR Clone

SKU
SC209953
3' UTR clone of potassium voltage-gated channel shaker-related subfamily member 5 (KCNA5) for miRNA target validation
$683.00
4 Weeks*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol KCNA5
Synonyms ATFB7; HCK1; HK2; HPCN1; KV1.5; PCN1
ACCN NM_002234
Insert Size 829 bp
Sequence Data
Insert Sequence
>SC209953 3’UTR clone of NM_002234
The sequence shown below is from the reference sequence of NM_002234. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGACACCAGCCGGGAAACAGATTTGTGAAAGGAGATTCAGGCAGACTGGTGGCAGTGGAGTAGGGAA
TGGGAGGCTTGCTGAACATGGATATCTACATTATACCGCAGAGTATTTGAAGTCACACTGTAACCTCAG
TCTACCCCTCTCCTTTCACTCCTTTCCTCCCTCCCTCGATCCCCCCATTTTCTCTATTCTTTCCATGAC
ACCCAAGGGTCGCCTATTTTTAAAAAGTACCACATTCCATGACGCAGGAGCTGTGGAAATGGTGAGCGC
TGTGAGATGGATGTATTTGTAGCCAGTCTCCTATACCCAGCAGAGGGATAACCCAAACAAAAATGACTC
TAAATAGCCCAGATCCCAAGAGATTATGTAACTCCTCCATCCATGTGTTCCAAATTTGCTTTACATATG
ATTGTATTTGTGTATAGGGGAAAATATTATTTTTATGCCTGGTAAGTGGCTTTTTGTACTGTAGTTCAG
ATAGAGATATTTTGGGTATATTTTCAAGATACATGTTGTATTTATGGAAGAAAGAGTTGTCCTGATGTT
TTTCTGTGTTACTTATATTAGAGTCAGAGATCTTGGTATGGGCTGTTCTGTTTCCTGTGTCTCCAAGCC
TCTGTCTTTTCTGGGATGTGGTATTGGTGCTTTGTGTCTAGGGCAGAGTATGTTCTTGAAGAAAGGCAA
ATCTGACTTTTTCTGTGCGCCTTAAACAATTCTTGTAACTTTCTTCAAAAAGCATTTTAATGATATTGG
AGGAATACTTCTGATAATTTATTGTCTTTATTTTTATCCCAGGAAATAAAAGGTTACCTTGTTGAGGCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002234.4
Locus ID 3741
Summary Potassium channels represent the most complex class of voltage-gated ino channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, the function of which could restore the resting membrane potential of beta cells after depolarization and thereby contribute to the regulation of insulin secretion. This gene is intronless, and the gene is clustered with genes KCNA1 and KCNA6 on chromosome 12. Defects in this gene are a cause of familial atrial fibrillation type 7 (ATFB7). [provided by RefSeq, May 2012]
Write Your Own Review
You're reviewing:KCNA5 (NM_002234) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.