CBLB (NM_170662) Human 3' UTR Clone

SKU
SC209114
3' UTR clone of Cas-Br-M (murine) ecotropic retroviral transforming sequence b (CBLB) for miRNA target validation
$683.00
In Stock*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol CBLB
Synonyms Cbl-b; Nbla00127; RNF56
ACCN NM_170662
Insert Size 730 bp
Sequence Data
Insert Sequence
>SC209114 3' UTR clone of NM_170662
The sequence shown below is from the reference sequence of NM_170662. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTTGCCTTCCCTCCTCCAGTATCCCCACGTCTAAATCTATAGCAGCCAGAACTGTAGACACCAAAATGGA
AAGCAATCGATGTATTCCAAGAGTGTGGAAATAAAGAGAACTGAGATGGAATTCAAGAGAGAAGTGTCTC
CTCCTCGTGTAGCAGCTTGAGAAGAGGCTTGGGAGTGCAGCTTCTCAAAGGAGACCGATGCTTGCTCAGG
ATGTCGACAGCTGTGGCTTCCTTGTTTTTGCTAGCCATATTTTTAAATCAGGGTTGAACTGACAAAAATA
ATTTAAAGACGTTTACTTCCCTTGAACTTTGAACCTGTGAAATGCTTTACCTTGTTTACAGTTTGGCAAA
GTTGCAGTTTGTTCTTGTTTTTAGTTTAGTTTTGTTTTGGTGTTTTGATACCTGTACTGTGTTCTTCACA
GACCCTTTGTAGCGTGGTCAGGTCTGCTGTAACATTTCCCACCAACTCTCTTGCTGTCCACATCAACAGC
TAAATCATTTATTCATATGGATCTCTACCATCCCCATGCCTTGCCCAGGTCCAGTTCCATTTCTCTCATT
CACAAGATGCTTTGAAGGTTCTGATTTTCAACTGATCAAACTAATGCAAAAAAAAAAAAGTATGTATTCT
TCACTACTGAGTTTCTTCTTTGGAAACCATCACTATTGAGAGATGGGAAAAACCTGAATGTATAAAGCAT
TTATTTGTCAATAAACTGCCTTTTGTAAGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_170662.3
Locus ID 868
Summary This gene encodes an E3 ubiquitin-protein ligase which promotes proteosome-mediated protein degradation by transferring ubiquitin from an E2 ubiquitin-conjugating enzyme to a substrate. The encoded protein is involved in the regulation of immune response by limiting T-cell receptor, B-cell receptor, and high affinity immunoglobulin epsilon receptor activation. Studies in mouse suggest that this gene is involved in antifungal host defense and that its inhibition leads to increased fungal killing. Manipulation of this gene may be beneficial in implementing immunotherapies for a variety of conditions, including cancer, autoimmune diseases, allergies, and infections. [provided by RefSeq, Sep 2017]
Write Your Own Review
You're reviewing:CBLB (NM_170662) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.