Aldolase C (ALDOC) (NM_005165) Human 3' UTR Clone

SKU
SC205743
3' UTR clone of aldolase C fructose-bisphosphate (ALDOC) for miRNA target validation
$683.00
4 Weeks*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Aldolase C
Synonyms ALDC
ACCN NM_005165
Insert Size 436 bp
Sequence Data
Insert Sequence
>SC205743 3’UTR clone of NM_005165
The sequence shown below is from the reference sequence of NM_005165. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCACTCTACATTGCCAACCATGCCTACTGAGTATCCACTCCATACCACAGCCCTTGGCCCAGCCATCTG
CACCCACTTTTGCTTGTAGTCATGGCCAGGGCCAAATAGCTATGCAGAGCAGAGATGCCTTCACCTGGC
ACCAACTTGTCTTCCTTTCTCTCTTCCCTTCCCCTCTCTCATTGCTGCACCTGGGACCATAGGATGGGA
GGATAGGGAGCCCCTCATGACTGAGGGCAGAAGAAATTGCTAGAAGTCAGAACAGGATGGCTGGGTCTC
CCCCTACCTCTTCCAGCTCCCACAATTTTCCCATGATGAGGTAGCTTCTCCCTGGGCTCTCCTTCTTGC
CTGCCCTGTCTCCTGGGATCAGAGGGTAGTACAGAAGCCCTGACTCATGCCTTGAGTACATACCATACA
GCAAATAAATGGTAGCAAAACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005165.3
Locus ID 230
Summary This gene encodes a member of the class I fructose-biphosphate aldolase gene family. Expressed specifically in the hippocampus and Purkinje cells of the brain, the encoded protein is a glycolytic enzyme that catalyzes the reversible aldol cleavage of fructose-1,6-biphosphate and fructose 1-phosphate to dihydroxyacetone phosphate and either glyceraldehyde-3-phosphate or glyceraldehyde, respectively. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:Aldolase C (ALDOC) (NM_005165) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.