PI 3 Kinase catalytic subunit alpha (PIK3CA) (NM_006218) Human 3' UTR Clone

SKU
SC204844
3' UTR clone of phosphoinositide-3-kinase catalytic alpha polypeptide (PIK3CA) for miRNA target validation
$683.00
In Stock*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol PI 3 Kinase catalytic subunit alpha
Synonyms CLAPO; CLOVE; CWS5; MCAP; MCM; MCMTC; p110-alpha; PI3K; PI3K-alpha
ACCN NM_006218
Insert Size 368 bp
Sequence Data
Insert Sequence
>SC204844 3' UTR clone of NM_006218
The sequence shown below is from the reference sequence of NM_006218. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCACACAATTAAACAGCATGCATTGAACTGAAAAGATAACTGAGAAAATGAAAGCTCACTCTGGATTCCA
CACTGCACTGTTAATAACTCTCAGCAGGCAAAGACCGATTGCATAGGAATTGCACAATCCATGAACAGCA
TTAGAATTTACAGCAAGAACAGAAATAAAATACTATATAATTTAAATAATGTAAACGCAAACAGGGTTTG
ATAGCACTTAAACTAGTTCATTTCAAAATTAAGCTTTAGAATAATGCGCAATTTCATGTTATGCCTTAAG
TCCAAAAAGGTAAACTTTGAAGATTGTTTGTATCTTTTTTTAAAAAACAAAACAAAACAAAAATCCCCAA
AATATATAGAAATGATGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006218.2
Locus ID 5290
Summary Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
Write Your Own Review
You're reviewing:PI 3 Kinase catalytic subunit alpha (PIK3CA) (NM_006218) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.