PI 3 Kinase catalytic subunit alpha (PIK3CA) (NM_006218) Human 3' UTR Clone

CAT#: SC204844

3' UTR clone of phosphoinositide-3-kinase catalytic alpha polypeptide (PIK3CA) for miRNA target validation


Reconstitution Protocol

USD 683.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "PI 3 Kinase catalytic subunit alpha"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PI 3 Kinase catalytic subunit alpha
Synonyms CLAPO; CLOVE; CWS5; MCAP; MCM; MCMTC; p110-alpha; PI3K; PI3K-alpha
ACCN NM_006218
Insert Size 368 bp
Sequence Data
>SC204844 3' UTR clone of NM_006218
The sequence shown below is from the reference sequence of NM_006218. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCACACAATTAAACAGCATGCATTGAACTGAAAAGATAACTGAGAAAATGAAAGCTCACTCTGGATTCCA
CACTGCACTGTTAATAACTCTCAGCAGGCAAAGACCGATTGCATAGGAATTGCACAATCCATGAACAGCA
TTAGAATTTACAGCAAGAACAGAAATAAAATACTATATAATTTAAATAATGTAAACGCAAACAGGGTTTG
ATAGCACTTAAACTAGTTCATTTCAAAATTAAGCTTTAGAATAATGCGCAATTTCATGTTATGCCTTAAG
TCCAAAAAGGTAAACTTTGAAGATTGTTTGTATCTTTTTTTAAAAAACAAAACAAAACAAAAATCCCCAA
AATATATAGAAATGATGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_006218.2
Summary Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
Locus ID 5290

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.