DGKA (NM_001345) Human 3' UTR Clone

SKU
SC203656
3' UTR clone of diacylglycerol kinase alpha 80kDa (DGKA) transcript variant 3 for miRNA target validation
$683.00
5 Days*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol DGKA
Synonyms DAGK; DAGK1; DGK-alpha
ACCN NM_001345
Insert Size 285 bp
Sequence Data
Insert Sequence
>SC203656 3’UTR clone of NM_001345
The sequence shown below is from the reference sequence of NM_001345. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCACCAATTTCTTTGGCTTCTTGAGCTAAGGGGGACACCCTTGGCCTCCAAGCCAGCCTTGAACCCAC
CTCCCTGTCCCTGGACTCTACTCCCGAGGCTCTGTACATTGCTGCCACATACTCCTGCCAGCTTGGGGG
AGTGTTCCTTCACCCTCACAGTATTTATTATCCTGCACCACCTCACTGTTCCCCATGCGCACACACATA
CACACACCCCAAAACACATACATTGAAAGTGCCTCATCTGAATAAAATGACTTGTGTTTCCCCTTTGGG
ATCTGCTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001345.5
Locus ID 1606
Summary The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Several transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Apr 2017]
Write Your Own Review
You're reviewing:DGKA (NM_001345) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.