Oct4 (POU5F1) (NM_002701) Human 3' UTR Clone

CAT#: SC203486

3' UTR clone of POU class 5 homeobox 1 (POU5F1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: Oct4
• Synonyms: Oct-3; Oct-4; OCT3; OCT4; OTF-3; OTF3; OTF4
• ACCN: NM_002701
• Insert Size: 294 bp
• Sequence Data:
  Insert Sequence

  >SC203486 3’UTR clone of NM_002701
  The sequence shown below is from the reference sequence of NM_002701. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  ACTCTGGGCTCTCCCATGCATTCAAACTGAGGTGCCTGCCCTTCTAGGAATGGGGGACAGGGGGAGGGG
  AGGAGCTAGGGAAAGAAAACCTGGAGTTTGTGCCAGGGTTTTTGGGATTAAGTTCTTCATTCACTAAGG
  AAGGAATTGGGAACACAAAGGGTGGGGGCAGGGGAGTTTGGGGCAACTGGTTGGAGGGAAGGTGAAGTT
  CAATGATGCTCTTGATTTTAATCCCACATCATGTATCACTTTTTTCTTAAATAAAGAAGCCTGGGACAC
  AGTAGATAGACACACTTA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002701.6
• Summary: This gene encodes a transcription factor containing a POU homeodomain that plays a key role in embryonic development and stem cell pluripotency. Aberrant expression of this gene in adult tissues is associated with tumorigenesis. This gene can participate in a translocation with the Ewing's sarcoma gene on chromosome 21, which also leads to tumor formation. Alternative splicing, as well as usage of alternative AUG and non-AUG translation initiation codons, results in multiple isoforms. One of the AUG start codons is polymorphic in human populations. Related pseudogenes have been identified on chromosomes 1, 3, 8, 10, and 12. [provided by RefSeq, Oct 2013]
• Locus ID: 5460
• MW: 10.9