MSH2 (NM_000251) Human 3' UTR Clone

CAT#: SC203467

3`UTR clone of mutS homolog 2 colon cancer nonpolyposis type 1 (E. coli) (MSH2) for miRNA target validation

Clone Modification / Custom Cloning Service

USD 526.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MSH2 (NM_000251) Human 3' UTR Clone
Vector pMirTarget
Symbol MSH2
Synonyms COCA1; FCC1; HNPCC; HNPCC1; LCFS2
ACCN NM_000251
Insert Size 273
Sequence Data
Insert Sequence
>SC203467 3'UTR clone of NM_000251
The sequence shown below is from the reference sequence of NM_000251. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTCACGAATAAAAGTTACTACGTGAAAAATCCCAGTAATGGAATGAAGGTAATATTGATAAGCTATTGTC
TGTAATAGTTTTATATTGTTTTATATTAACCCTTTTTCCATAGTGTTAACTGTCAGTGCCCATGGGCTAT
CAACTTAATAAGATATTTAGTAATATTTTACTTTGAGGACATTTTCAAAGATTTTTATTTTGAAAAATGA
GAGCTGTAACTGAGGACTGTTTGCAATTGACATAGGCAATAATAAGTGATGTGCTGAATTTTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000251.1
Synonyms COCA1; FCC1; HNPCC; HNPCC1; LCFS2
Summary This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Locus ID 4436
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (2)

Documents