PPAR gamma (PPARG) (NM_138712) Human 3' UTR Clone

CAT#: SC202417

3' UTR clone of peroxisome proliferator-activated receptor gamma (PPARG) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PPAR gamma
• Synonyms: CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARG5; PPARgamma
• ACCN: NM_138712
• Insert Size: 229 bp
• Sequence Data:
  Insert Sequence

  >SC202417 3’UTR clone of NM_138712
  The sequence shown below is from the reference sequence of NM_138712. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CTGCAGGAGATCTACAAGGACTTGTACTAGCAGAGAGTCCTGAGCCACTGCCAACATTTCCCTTCTTCC
  AGTTGCACTATTCTGAGGGAAAATCTGACACCTAAGAAATTTACTGTGAAAAAGCATTTTAAAAAGAAA
  AGGTTTTAGAATATGATCTATTTTATGCATATTGTTTATAAAGACACATTTACAATTTACTTTTAATAT
  TAAAAATTACCATATTATGAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_138712.5
• Summary: This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) subfamily of nuclear receptors. PPARs form heterodimers with retinoid X receptors (RXRs) and these heterodimers regulate transcription of various genes. Three subtypes of PPARs are known: PPAR-alpha, PPAR-delta, and PPAR-gamma. The protein encoded by this gene is PPAR-gamma and is a regulator of adipocyte differentiation. Additionally, PPAR-gamma has been implicated in the pathology of numerous diseases including obesity, diabetes, atherosclerosis and cancer. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]
• Locus ID: 5468
• MW: 9.5