GAPDH (NM_002046) Human 3' UTR Clone

SKU
SC202241
3' UTR clone of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for miRNA target validation
$683.00
5 Days*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol GAPDH
Synonyms G3PD; GAPD; HEL-S-162eP
ACCN NM_002046
Insert Size 231 bp
Sequence Data
Insert Sequence
>SC202241 3’UTR clone of NM_002046
The sequence shown below is from the reference sequence of NM_002046. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCATGGCCCACATGGCCTCCAAGGAGTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCACAAGAGGA
AGAGAGAGACCCTCACTGCTGGGGAGTCCCTGCCACACTCAGTCCCCCACCACACTGAATCTCCCCTCC
TCACAGTTGCCATGTAGACCCCTTGAAGAGGGGAGGGGCCTAGGGAGCCGCACCTTGTCATGTACCATC
AATAAAGTACCCTGTGCTCAACCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002046.7
Locus ID 2597
Summary This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The product of this gene catalyzes an important energy-yielding step in carbohydrate metabolism, the reversible oxidative phosphorylation of glyceraldehyde-3-phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide (NAD). The encoded protein has additionally been identified to have uracil DNA glycosylase activity in the nucleus. Also, this protein contains a peptide that has antimicrobial activity against E. coli, P. aeruginosa, and C. albicans. Studies of a similar protein in mouse have assigned a variety of additional functions including nitrosylation of nuclear proteins, the regulation of mRNA stability, and acting as a transferrin receptor on the cell surface of macrophage. Many pseudogenes similar to this locus are present in the human genome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Write Your Own Review
You're reviewing:GAPDH (NM_002046) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.