Proteasome subunit alpha type 6 (PSMA6) (NM_002791) Human 3' UTR Clone

SKU
SC201979
3' UTR clone of proteasome (prosome macropain) subunit alpha type 6 (PSMA6) for miRNA target validation
$683.00
4 Weeks*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Proteasome subunit alpha type 6
Synonyms IOTA; p27K; PROS27
ACCN NM_002791
Insert Size 217 bp
Sequence Data
Insert Sequence
>SC201979 3’UTR clone of NM_002791
The sequence shown below is from the reference sequence of NM_002791. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACCTTGTTGCTCTAGCAGAGAGAGACTAAACATTGTCGTTAGTTTACCAGATCCGTGATGCCACTTAC
CTGTGTGTTTGGTAACAACAAACCAACATCATGGAGGTCCCTGGATTGAAAAAGGAGCCTCTCCCACTC
CTCCTACCACCGAAGTGGTTAGGACTCTATATAAATAAAAACAAGGCTTTTGGAAAATAATTGCATCCT
GTTGTTTTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002791.3
Locus ID 5687
Summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple transcript variants encoding several different isoforms have been found for this gene. A pseudogene has been identified on the Y chromosome. [provided by RefSeq, Aug 2013]
Write Your Own Review
You're reviewing:Proteasome subunit alpha type 6 (PSMA6) (NM_002791) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.