Myeloid zinc finger 1 (MZF1) (NM_198055) Human 3' UTR Clone

SKU
SC201770
3' UTR clone of myeloid zinc finger 1 (MZF1) transcript variant 2 for miRNA target validation
$683.00
4 Weeks*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Myeloid zinc finger 1
Synonyms MZF-1; MZF1B; ZFP98; ZNF42; ZSCAN6
ACCN NM_198055
Insert Size 170 bp
Sequence Data
Insert Sequence
>SC201770 3’UTR clone of NM_198055
The sequence shown below is from the reference sequence of NM_198055. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGCACCAGCGCGTCCACAGCGCCGAGTAGCTCCAGCCGGGACGCACTGTGTCCGCCATGGTCAGAACA
CCTACCTCCCCTGGTTATTGTGAGGCTGGCGATTACATAAGTATAAGCAGGTCCGCCCAGGGCTTGGCT
ACTGTAGGTGTCCAATAAACAGTAGATGGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_198055.2
Locus ID 7593
Summary Binds to target promoter DNA and functions as transcription regulator. Regulates transcription from the PADI1 and CDH2 promoter. May be one regulator of transcriptional events during hemopoietic development.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Myeloid zinc finger 1 (MZF1) (NM_198055) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.