PTGR1 (NM_001146108) Human 3' UTR Clone

CAT#: SC201488

3`UTR clone of prostaglandin reductase 1 (PTGR1) transcript variant 1 for miRNA target validation

Change vector?

USD 526.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PTGR1 (NM_001146108) Human 3' UTR Clone
Vector pMirTarget
Symbol PTGR1
Synonyms LTB4DH; PGR1; ZADH3
ACCN NM_001146108
Insert Size 148
Sequence Data
Insert Sequence
>SC201488 3'UTR clone of NM_001146108
The sequence shown below is from the reference sequence of NM_001146108. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAAGACAATAGTGAAAGCATGAAAAAGAGGACACATGGAATCTGGAGGCCATTTAGATGATTAGTTAAT
TTGTTTTTCACCATTTAGCAAAAATGTATACTACCTTAAATGTCTTAAGAAATAGTACTCATAATGAGTT
TGAGCTAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001146108.1
Synonyms LTB4DH; PGR1; ZADH3
Summary This gene encodes an enzyme that is involved in the inactivation of the chemotactic factor, leukotriene B4. The encoded protein specifically catalyzes the NADP+ dependent conversion of leukotriene B4 to 12-oxo-leukotriene B4. A pseudogene of this gene is found on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009].
Locus ID 22949
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations

Documents