MirLet7a-1 Mouse MicroRNA Expression Plasmid (MI0000556)

CAT#: SC400707

Expression plasmid for mouse microRNA Let7a-1

USD 340.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Species Mouse
Vector pCMV-MIR
Sequence Data
Precursor:
UUCACUGUGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUAAGGUGAU
Mature Sequence:
UGAGGUAGUAGGUUGUAUAGUU

Full insert
>MI0000556 CTAGGTTTTTGGATTGGGGACATTTAAGCTTCAGTATTAGACAGTGGTAAGAATGTAATTTCTAGATCTTATAACATATTGAATTAGAGGCTTATAGCCCAGGTGTATCATATAATACAATGAAACTACAATATAGGTCATATATGTAACTGTTCAGTTAAACTTCATGTTCAAGTTAAAGTAGTGAAAATCTAATATTTTCTTTTCCCTCATTACACAGGAAACCGGAATTACAAAGGAGAACGGCTTCCTGTGATGCTCAGCTGTGATTACTTTCAACATTCACCCTGGATGTTCTCTTCACTGTGGGATGAGGTAGTAGGTTGTATAGTTTTAGGGTCACACCCACCACTGGGAGATAACTATACAATCTACTGTCTTTCCTAAGGTGATGGAAAAGTCTGCATTCATGGGGTCTCATAGGAAACCAAGAACAAACTGCAGTGTTTTAAAGTATATCTTGCCTTAAAAGCATTTGCTTATGCTATGCATGCTTTTTAATTTAACAAGTAGATGATGGGAATGGGCAAGTTTTTACTTACTTTGCATTCTGTGTCAATGTAAATGAAGATTTAATTTTGATTGATGATGATGATTTAATGTTAACCTTTCTTGAAAGAGACTGATGCTTATTCCAGAAGAAAAACTTGCTCTATCAGAGTGAGGTAGT
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA
Antibiotic Selection Neomycin and Kanamycin
Product Components The plasmid is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
Reference Data
RefSeq MI0000556
Synonyms Mirnlet7a Mirnlet7a-1
Locus ID 387244
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations