MIR34a Human MicroRNA Expression Plasmid (MI0000268)

CAT#: SC400356

Reviews ()
Write a review

Expression plasmid for human microRNA MIR34a



USD 396.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Precursor:
GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC
Mature Sequence:
UGGCAGUGUCUUAGCUGGUUGU
>MI0000268 ATCACAGCTCCCTGCAGCCTCAACCCCTGGGCTCAAGCGATCCTCCTGCCCTGGCCTCTCCAGTAGCTAG
GACTACAGGCACGCATGTCACCATGCCTGGCTAATTTTTAAAATTTTTTTGTAGAGATGGAGTCTTGCTA
GTTGCCTGGGCTGGTCTTGAACTCCTGGCCTGAAGCGATCCTCCCACCTCGGCCTCCTGCATCCTTTCTT
TCCTCCCCACATTTCCTTCTTATCAACAGGTGCTGGGGAGAGGCAGGACAGGCCTGTCCCCCGAGTCCCC
TCCGGATGCCGTGGACCGGCCAGCTGTGAGTGTTTCTTTGGCAGTGTCTTAGCTGGTTGTTGTGAGCAAT
AGTAAGGAAGCAATCAGCAAGTATACTGCCCTAGAAGTGCTGCACGTTGTGGGGCCCAAGAGGGAAGATG
AAGCGAGAGATGCCCAGACCAGTGGGAGACGCCAGGACTTCGGAAGCTCTTCTGCGCCACGGTGGGTGGT
GAGGGCGGCTGGGAAAGTGAGCTCCAGGGCCCCAGGAGCAGCCTGCTCGTGGGTGCGGAAGGAAAAAGGC
ACAGGGGCTTGGTGTGGGCGGCTTTTGGCTGGGAGAAGTTTGCACGTAGGGAGAATAGTAGCCAGTGTTT
GCAGAGCACTTACTATGCAGGAAGGCCTGTCCTAAGTATTGTAAGTGTATTACATCATGTACAAGTGTCT
GT
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Product Components The plasmid is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
Reference Data
RefSeq MI0000268
Synonyms MIRN34A miRNA34A
Locus ID 407040
Other products for "MIR34a"
Frequently bought together (1)
DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.