SARS-CoV-2 (COVID-19) qPCR Primer Pair N protein
CAT#: HP234775
qSTAR qPCR primer pairs against SARS-CoV-2 (COVID-19) Nucleocapsid Phosphoprotein (N protein) gene
SensiMix SYBR Master Mix
USD 142.00
5 Days*
USD 305.00
USD 457.00
Specifications
Product Data | |
Gene ID | 43740575 |
Forward Sequence | aagctggacttccctatggtg |
Reverse Sequence | cgattgcagcattgttagcagg |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
Be the first one to submit a review