SARS-CoV-2 (COVID-19) qPCR Primer Pair N protein

CAT#: HP234775

Reviews ()
Write a review

qSTAR qPCR primer pairs against SARS-CoV-2 (COVID-19) Nucleocapsid Phosphoprotein (N protein) gene



SensiMix SYBR Master Mix

USD 132.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 43740575
Forward Sequence aagctggacttccctatggtg
Reverse Sequence cgattgcagcattgttagcagg
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "N Protein"
Frequently bought together (1)
SARS-CoV-2 N Protein Rabbit Polyclonal Antibody
    • 100 ul

USD 417.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools