GRK5 Human Gene Knockout Kit (CRISPR)
CAT#: KN209137
GRK5 - human gene knockout kit via CRISPR, HDR mediated
Functional Cassette: Luciferase-Puro RFP-BSD mBFP-Neo
HDR-mediated knockout kit validation
USD 1,657.00
4 Weeks*
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
Donor DNA | GFP-puro |
Symbol | GRK5 |
Locus ID | 2869 |
Components |
KN209137G1, GRK5 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGAAAACATCGTGGCCAACA KN209137G2, GRK5 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GTCTTGCTGAAAGCCAGGGA KN209137D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_005308 |
UniProt ID | P34947 |
Synonyms | GPRK5 |
Summary | This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. It has also been shown to play a role in regulating the motility of polymorphonuclear leukocytes (PMNs). [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN209137BN | GRK5 - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN209137LP | GRK5 - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN209137RB | GRK5 - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN409137 | GRK5 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
USD 1,657.00 |
|
GA101929 | GRK5 CRISPRa kit - CRISPR gene activation of human G protein-coupled receptor kinase 5 |
USD 1,657.00 |
{0} Product Review(s)
Be the first one to submit a review