Cannabinoid Receptor I(CNR1) (NM_033181) Human Untagged Clone

CAT#: SC327858

CNR1 (untagged)-Human cannabinoid receptor 1 (brain) (CNR1) transcript variant 2

USD 701


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cannabinoid Receptor I(CNR1) (NM_033181) Human Untagged Clone
Symbol CNR1
Synonyms CANN6; CB-R; CB1; CB1A; CB1K5; CB1R; CNR
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_033181, the custom clone sequence may differ by one or more nucleotides


ATGAAGTCGATCCTAGATGGCCTTGCAGATACCACCTTCCGCACCATCACCACTGACCTCCTGGGAAGTC
CCTTCCAAGAGAAGATGACTGCGGGAGACAACCCCCAGCTAGTCCCAGCAGACCAGGTGAACATTACAGA
ATTTTACAACAAGTCTCTCTCGTCCTTCAAGGAGAATGAGGAGAACATCCAGTGTGGGGAGAACTTCATG
GACATAGAGTGTTTCATGGTCCTGAACCCCAGCCAGCAGCTGGCCATTGCAGTCCTGTCCCTCACGCTGG
GCACCTTCACGGTCCTGGAGAACCTCCTGGTGCTGTGCGTCATCCTCCACTCCCGCAGCCTCCGCTGCAG
GCCTTCCTACCACTTCATCGGCAGCCTGGCGGTGGCAGACCTCCTGGGGAGTGTCATTTTTGTCTACAGC
TTCATTGACTTCCACGTGTTCCACCGCAAAGATAGCCGCAACGTGTTTCTGTTCAAACTGGGTGGGGTCA
CGGCCTCCTTCACTGCCTCCGTGGGCAGCCTGTTCCTCACAGCCATCGACAGGTACATATCCATTCACAG
GCCCCTGGCCTATAAGAGGATTGTCACCAGGCCCAAGGCCGTGGTGGCGTTTTGCCTGATGTGGACCATA
GCCATTGTGATCGCCGTGCTGCCTCTCCTGGGCTGGAACTGCGAGAAACTGCAATCTGTTTGCTCAGACA
TTTTCCCACACATTGATGAAACCTACCTGATGTTCTGGATCGGGGTCACCAGCGTACTGCTTCTGTTCAT
CGTGTATGCGTACATGTATATTCTCTGGAAGGCTCACAGCCACGCCGTCCGCATGATTCAGCGTGGCACC
CAGAAGAGCATCATCATCCACACGTCTGAGGATGGGAAGGTACAGGTGACCCGGCCAGACCAAGCCCGCA
TGGACATTAGGTTAGCCAAGACCCTGGTCCTGATCCTGGTGGTGTTGATCATCTGCTGGGGCCCTCTGCT
TGCAATCATGGTGTATGATGTCTTTGGGAAGATGAACAAGCTCATTAAGACGGTGTTTGCATTCTGCAGT
ATGCTCTGCCTGCTGAACTCCACCGTGAACCCCATCATCTATGCTCTGAGGAGTAAGGACCTGCGACACG
CTTTCCGGAGCATGTTTCCCTCTTGTGAAGGCACTGCGCAGCCTCTGGATAACAGCATGGGGGACTCGGA
CTGCCTGCACAAACACGCAAACAATGCAGCCAGTGTTCACAGGGCCGCAGAAAGCTGCATCAAGAGCACG
GTCAAGATTGCCAAGGTAACCATGTCTGTGTCCACAGACACGTCTGCCGAGGCTCTGTGA


Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_033181
ORF Size 1320 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_033181.3, NP_149421
RefSeq Size 5387
RefSeq ORF 1320
Locus ID 1268
Cytogenetics 6q15
Domains 7tm_1
Protein Families GPCR, Transmembrane, Druggable Genome
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary This gene encodes one of two cannabinoid receptors. The cannabinoids, principally delta-9-tetrahydrocannabinol and synthetic analogs, are psychoactive ingredients of marijuana. The cannabinoid receptors are members of the guanine-nucleotide-binding protein (G-protein) coupled receptor family, which inhibit adenylate cyclase activity in a dose-dependent, stereoselective and pertussis toxin-sensitive manner. The two receptors have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. Multiple transcript variants encoding two different protein isoforms have been described for this gene. [provided by RefSeq, May 2009]
Transcript Variant: This variant (2) lacks an internal segment near the 5' end of the coding region, compared to variant 1. The resulting protein (isoform b) has a shorter and distinct N-terminus compared to isoform a. PubMed ID: 15620723 referred to this variant and its protein as CB1b.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations