DAXX (NM_001141969) Human Untagged Clone

CAT#: SC325313

Reviews ()
Write a review

DAXX (untagged)-Human death-domain associated protein (DAXX), transcript variant 1



Reconstitution Protocol

USD 679.00

In Stock*

Size
    • 10 ug

Product images

Other products for "DAXX"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DAXX
Synonyms BING2; DAP6; EAP1; SMIM40
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001141969 edited
GGAAGGAAGGCGGAGGGAACCATGCGAGGTTCTGAGAATTGCGGCGAGGGTCGCCTCGAG
AGACGGTTTCTGAGCAGGAATTCTGAAATCCCCACCACTTCCTCCCTCCGGGGGATTTGA
TCCCCTATGGCCACCGCTAACAGCATCATCGTGCTGGATGATGATGACGAAGATGAAGCA
GCTGCTCAGCCAGGGCCCTCCCACCCACTCCCCAATGCGGCCTCACCTGGGGCAGAAGCC
CCTAGCTCCTCTGAGCCTCATGGGGCCAGAGGAAGCAGTAGTTCGGGCGGCAAGAAATGC
TACAAGCTGGAGAATGAGAAGCTGTTCGAAGAGTTCCTTGAACTTTGTAAGATGCAGACA
GCAGACCACCCTGAGGTGGTCCCATTCCTCTATAACCGGCAGCAACGTGCCCACTCTCTG
TTTTTGGCCTCGGCGGAGTTCTGCAACATCCTCTCTAGGGTCCTGTCTCGGGCCCGGAGC
CGGCCAGCCAAGCTCTATGTCTACATCAATGAGCTCTGCACTGTTCTCAAGGCCCACTCA
GCCAAAAAGAAGCTGAACTTGGCCCCTGCCGCCACCACCTCCAATGAGCCCTCTGGGAAT
AACCCTCCCACACACCTCTCCTTGGACCCCACAAATGCTGAAAACACTGCCTCTCAGTCT
CCAAGGACCCGTGGTTCCCGGCGGCAGATCCAGCGTTTGGAGCAGCTGCTGGCGCTCTAT
GTGGCAGAGATCCGGCGGCTGCAGGAAAAGGAGTTGGATCTCTCAGAATTGGATGACCCA
GACTCCGCATACCTGCAGGAGGCACGGTTGAAGCGTAAGCTGATCCGCCTCTTTGGGCGA
CTATGTGAGCTGAAAGACTGCTCTTCACTGACCGGCCGTGTCATAGAGCAGCGCATCCCC
TACCGTGGCACCCGCTACCCAGAGGTTAACAGGCGCATTGAGCGGCTCATCAACAAGCCA
GGGCCTGATACCTTCCCTGACTATGGGGATGTGCTTCGGGCTGTAGAGAAGGCAGCTGCC
CGACACAGCCTTGGCCTCCCCCGACAGCAGCTCCAGCTCATGGCTCAGGATGCCTTCCGA
GATGTGGGCATCAGGTTACAGGAGCGACGTCACCTCGATCTCATCTACAACTTTGGCTGC
CACCTCACAGATGACTATAGGCCAGGCGTTGACCCTGCACTATCAGATCCTGTGTTGGCC
CGGCGCCTTCGGGAAAACCGGAGTTTGGCCATGAGTCGGCTGGATGAGGTCATCTCCAAA
TATGCAATGTTGCAAGACAAAAGTGAGGAGGGCGAGAGAAAAAAGAGAAGAGCTCGGCTC
CAAGGCACCTCTTCCCACTCTGCAGACACCCCCGAAGCCTCCTTGGATTCTGGTGAGGGC
CCTAGTGGAATGGCATCCCAGGGGTGCCCTTCTGCCTCCAGAGCTGAGACAGATGACGAA
GACGATGAGGAGAGTGATGAGGAAGAGGAGGAGGAGGAGGAAGAAGAAGAGGAGGAGGCC
ACAGATTCTGAAGAGGAGGAGGATCTGGAACAGATGCAGGAGGGTCAGGAGGATGATGAA
GAGGAGGACGAAGAGGAAGAAGCAGCAGCAGGTAAAGATGGAGACAAGAGCCCCATGTCC
TCACTACAGATCTCCAATGAAAAGAACCTGGAACCTGGCAAACAGATCAGCAGATCTTCA
GGGGAGCAGCAAAACAAAGGACGCATAGTGTCACCATCGTTACTGTCAGAAGAACCCCTG
GCCCCCTCCAGCATAGATGCTGAAAGCAATGGAGAACAGCCTGAGGAGCTGACCCTGGAG
GAAGAAAGCCCTGTGTCTCAGCTCTTTGAGCTAGAGATTGAAGCTTTGCCCCTGGATACC
CCTTCCTCTGTGGAGACGGACATTTCCTCTTCCAGGAAGCAATCAGAGGAGCCCTTCACC
ACTGTCTTAGAGAATGGAGCAGGCATGGTCTCTTCTACTTCCTTCAATGGAGGCGTCTCT
CCTCACAACTGGGGAGATTCTGGTCCCCCCTGCAAAAAATCTCGGAAGGAGAAGAAGCAA
ACAGGATCAGGGCCATTAGGAAACAGCTATGTGGAAAGGCAAAGGTCAGTGCATGAGAAG
AATGGGAAAAAGATATGTACCCTGCCCAGCCCACCTTCCCCCTTGGCTTCCTTGGCCCCA
GTTGCTGATTCCTCCACGAGGGTGGACTCTCCCAGCCATGGCCTGGTGACCAGCTCCCTC
TGCATCCCTTCTCCAGCCCGGCTGTCCCAAACCCCCCATTCACAGCCTCCTCGGCCTGGT
ACTTGCAAGACAAGTGTGGCCACACAATGCGATCCAGAAGAGATCATCGTGCTCTCAGAC
TCTGATTAGCTGCCTCCCCTTCTCCCTGCCTCCAGAATGTTCTGGGATAACATTTGGAGG
AAGGTGGGAAGCAGATGACTGAGGAAGGGATGGAATAAGCTAATCCCCTTTTGGTGGTGT
TTCTTTAAAAAAAGAAAAAAAAGCTTAAGTTTTACTCAGAAACATTAATAAACAATAAAG
TTCTTTTTCTTCCTGTAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites NotI-NotI     
ACCN NM_001141969
Insert Size 2600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001141969.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001141969.1, NP_001135441.1
RefSeq Size 2632 bp
RefSeq ORF 2223 bp
Locus ID 1616
UniProt ID Q9UER7
Cytogenetics 6p21.32
Protein Families Druggable Genome, Stem cell - Pluripotency, Transcription Factors
Protein Pathways Amyotrophic lateral sclerosis (ALS), MAPK signaling pathway
Gene Summary This gene encodes a multifunctional protein that resides in multiple locations in the nucleus and in the cytoplasm. It interacts with a wide variety of proteins, such as apoptosis antigen Fas, centromere protein C, and transcription factor erythroblastosis virus E26 oncogene homolog 1. In the nucleus, the encoded protein functions as a potent transcription repressor that binds to sumoylated transcription factors. Its repression can be relieved by the sequestration of this protein into promyelocytic leukemia nuclear bodies or nucleoli. This protein also associates with centromeres in G2 phase. In the cytoplasm, the encoded protein may function to regulate apoptosis. The subcellular localization and function of this protein are modulated by post-translational modifications, including sumoylation, phosphorylation and polyubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
Transcript Variant: This variant (1) represents the longest transcript but encodes the shorter isoform (a). Variants 1 and 2 encode the same isoform (a).
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.