PDGF beta(PDGFB) (NM_002608) Human Untagged Clone

CAT#: SC324287

PDGFB (untagged)-Human platelet-derived growth factor beta polypeptide (PDGFB), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PDGF beta(PDGFB) (NM_002608) Human Untagged Clone
Symbol PDGFB
Synonyms c-sis; IBGC5; PDGF-2; PDGF2; SIS; SSV
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002608.1 GACGCCTCGGCTGGTTCGCGACGCAGCCCCCCGGCCGTGGATGCTCACTCGGGCTCGGGA
TCCGCCCAGGTAGCGGCCTCGGACCCAGGTCCTGCGCCCAGGTCCTCCCCTGCCCCCCAG
CGACGGAGCCGGGGCCGGGGGCGGCGGCGCCCGGGGGCCATGCGGGTGAGCCGCGGCTGC
AGAGGCCTGAGCGCCTGATCGCCGCGGACCCGAGCCGAGCCCACCCCCCTCCCCAGCCCC
CCACCCTGGCCGCGGGGGCGGCGCGCTCGATCTACGCGTCCGGGGCCCCGCGGGGCCGGG
CCCGGAGTCGGCATGAATCGCTGCTGGGCGCTCTTCCTGTCTCTCTGCTGCTACCTGCGT
CTGGTCAGCGCCGAGGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCAC
TCGATCCGCTCCTTTGATGATCTCCAACGCCTGCTGCACGGAGACCCCGGAGAGGAAGAT
GGGGCCGAGTTGGACCTGAACATGACCCGCTCCCACTCTGGAGGCGAGCTGGAGAGCTTG
GCTCGTGGAAGAAGGAGCCTGGGTTCCCTGACCATTGCTGAGCCGGCCATGATCGCCGAG
TGCAAGACGCGCACCGAGGTGTTCGAGATCTCCCGGCGCCTCATAGACCGCACCAACGCC
AACTTCCTGGTGTGGCCGCCCTGTGTGGAGGTGCAGCGCTGCTCCGGCTGCTGCAACAAC
CGCAACGTGCAGTGCCGCCCCACCCAGGTGCAGCTGCGACCTGTCCAGGTGAGAAAGATC
GAGATTGTGCGGAAGAAGCCAATCTTTAAGAAGGCCACGGTGACGCTGGAAGACCACCTG
GCATGCAAGTGTGAGACAGTGGCAGCTGCACGGCCTGTGACCCGAAGCCCGGGGGGTTCC
CAGGAGCAGCGAGCCAAAACGCCCCAAACTCGGGTGACCATTCGGACGGTGCGAGTCCGC
CGGCCCCCCAAGGGCAAGCACCGGAAATTCAAGCACACGCATGACAAGACGGCACTGAAG
GAGACCCTTGGAGCCTAGGGGCATCGGCAGGAGAGTGTGTGGGCAGGGTTATTTAATATG
GTATTTGCTGTATTGCCCCCATGGGGTCCTTGGAGTGATAATATTGTTTCCCTCGTCCGT
CTGTCTCGATGCCTGATTCGGACGGCCAATGGTGCTTCCCCCACCCCTCCACGTGTCCGT
CCACCCTTCCATCAGCGGGTCTCCTCCCAGCGGCCTCCGGCGTCTTGCCCAGCAGCTCAA
GAAGAAAAAGAAGGACTGAACTCCATCGCCATCTTCTTCCCTTAACTCCAAGAACTTGGG
ATAAGAGTGTGAGAGAGACTGATGGGGTCGCTCTTTGGGGGAAACGGGCTCCTTCCCCTG
CACCTGGCCTGGGCCACACCTGAGCGCTGTGGACTGTCCTGAGGAGCCCTGAGGACCTCT
CAGCATAGCCTGCCTGATCCCTGAACCCCTGGCCAGCTCTGAGGGGAGGCACCTCCAGGC
AGGCCAGGCTGCCTCGGACTCCATGGCTAAGACCACAGACGGGCACACAGACTGGAGAAA
ACCCCTCCCACGGTGCCCAAACACCAGTCACCTCGTCTCCCTGGTGCCTCTGTGCACAGT
GGCTTCTTTTCGTTTTCGTTTTGAAGACGTGGACTCCTCTTGGTGGGTGTGGCCAGCACA
CCAAGTGGCTGGGTGCCCTCTCAGGTGGGTTAGAGATGGAGTTTGCTGTTGAGGTGGCTG
TAGATGGTGACCTGGGTATCCCCTGCCTCCTGCCACCCCTTCCTCCCCACACTCCACTCT
GATTCACCTCTTCCTCTGGTTCCTTTCATCTCTCTACCTCCACCCTGCATTTTCCTCTTG
TCCTGGCCCTTCAGTCTGCTCCACCAAGGGGCTCTTGAACCCCTTATTAAGGCCCCAGAT
GATCCCAGTCACTCCTCTCTAGGGCAGAAGACTAGAGGCCAGGGCAGCAAGGGACCTGCT
CATCATATTCCAACCCAGCCACGACTGCCATGTAAGGTTGTGCAGGGTGTGTACTGCACA
AGGACATTGTATGCAGGGAGCACTGTTCACATCATAGATAAAGCTGATTTGTATATTTAT
TATGACAATTTCTGGCAGATGTAGGTAAAGAGGAAAAGGATCCTTTTCCTAATTCACACA
AAGACTCCTTGTGGACTGGCTGTGCCCCTGATGCAGCCTGTGGCTTGGAGTGGCCAAATA
GGAGGGAGACTGTGGTAGGGGCAGGGAGGCAACACTGCTGTCCACATGACCTCCATTTCC
CAAAGTCCTCTGCTCCAGCAACTGCCCTTCCAGGTGGGTGTGGGACACCTGGGAGAAGGT
CTCCAAGGGAGGGTGCAGCCCTCTTGCCCGCACCCCTCCCTGCTTGCACACTTCCCCATC
TTTGATCCTTCTGAGCTCCACCTCTGGTGGCTCCTCCTAGGAAACCAGCTCGTGGGCTGG
GAATGGGGGAGAGAAGGGAAAAGATCCCCAAGACCCCCTGGGGTGGGATCTGAGCTCCCA
CCTCCCTTCCCACCTACTGCACTTTCCCCCTTCCCGCCTTCCAAAACCTGCTTCCTTCAG
TTTGTAAAGTCGGTGATTATATTTTTGGGGGCTTTCCTTTTATTTTTTAAATGTAAAATT
TATTTATATTCCGTATTTAAAGTTGTAAAAAAAAATAACCACAAAACAAAACCAAAAAAA
AAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002608.1 unedited
AGGATCATACCTGCTACACCGCCTCCCGCTGTTTTGACCTTATAAAAGAACCGGGCCCGA
TCCCCCTCCGGTCTCTACTACTAGGCCGCGGGACGGATAACATTTTCCCACAGGAAACAG
CTATGACCATTCCTCCTATTTAGGTGACACTATACAACTTGTTTGTACAAAACAGCATGC
TGGTACCGGTCCGGAATTCCCGGCATGACGCCTCGGCTGGTTCGCGACGCAGCCCCCCGG
CCGTGGCTGCTCACTCTGGCTCGGGATCCGCCCAGGTAGCGGCCTCGGACCCAGGTCCTG
CGCCCAGGTCCTCCCCTGCCCCCCAGCGACGGAGCCGGGGCCGGGGGCGGCGGCGCCCGG
GGGCCATGCGGGTGAGCCGCGGCTGCAGAGGCCTGAGCGCCTGATCGCCGCGGACCCGAG
CCGAGCCCACCCCCCTCCCCAGCCCCCCACCCTGGCCGCGGGGGCGGCGCGCTCGATCTA
CGCGTCCGGGGCCCCGCGGGGCCGGGCCCGGAGTCGGCATGAATCGCTGCTGGGCGCTCT
TCCTGTCTCTCTGCTGCTACCTGCGTCTGGTCAGCGCCGAGGGGGACCCCATTCCCCGAG
GAGCCTTTATGAGATGCTGAGTGACCACTTCGATCCCCCTCCTTTGATGATCTCCCACGC
CTGCTGCCCCGGAGACCCCGGAGAGGAAGAATGGGGCCGAATTGGAACCTTGAACATGAC
CCCGCTCCCACTCTGGAAGGCTAAGCTGGATAACCTTGGCTTTG
Tag Tag Free
ACCN NM_002608
ORF Size 726 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002608.1, NP_002599
RefSeq Size 3373
Locus ID 5155
Cytogenetics 22q13.1
Domains PDGF, PDGF_N
Protein Families Druggable Genome
Protein Pathways MAPK signaling pathway, Cytokine-cytokine receptor interaction, Focal adhesion, Gap junction, Regulation of actin cytoskeleton, Pathways in cancer, Renal cell carcinoma, Glioma, Prostate cancer, Melanoma
Gene Summary This gene encodes a member of the protein family comprised of both platelet-derived growth factors (PDGF) and vascular endothelial growth factors (VEGF). The encoded preproprotein is proteolytically processed to generate platelet-derived growth factor subunit B, which can homodimerize, or alternatively, heterodimerize with the related platelet-derived growth factor subunit A. These proteins bind and activate PDGF receptor tyrosine kinases, which play a role in a wide range of developmental processes. Mutations in this gene are associated with meningioma. Reciprocal translocations between chromosomes 22 and 17, at sites where this gene and that for collagen type 1, alpha 1 are located, are associated with dermatofibrosarcoma protuberans, a rare skin tumor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015].
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1), which contains a signal peptide.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.