YES1 (NM_005433) Human Untagged Clone

CAT#: SC323601

Reviews ()
Write a review

YES1 (untagged)-Kinase deficient mutant (K305M) of Human v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 (YES1)



  "NM_005433" in other vectors (7)

Reconstitution Protocol

USD 506.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "YES1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol YES1
Synonyms c-yes; HsT441; P61-YES; Yes
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_005433, the custom clone sequence may differ by one or more nucleotides


ATGGGCTGCATTAAAAGTAAAGAAAACAAAAGTCCAGCCATTAAATACAGACCTGAAAATACTCCAGAGC
CTGTCAGTACAAGTGTGAGCCATTATGGAGCAGAACCCACTACAGTGTCACCATGTCCGTCATCTTCAGC
AAAGGGAACAGCAGTTAATTTCAGCAGTCTTTCCATGACACCATTTGGAGGATCCTCAGGGGTAACGCCT
TTTGGAGGTGCATCTTCCTCATTTTCAGTGGTGCCAAGTTCATATCCTGCTGGTTTAACAGGTGGTGTTA
CTATATTTGTGGCCTTATATGATTATGAAGCTAGAACTACAGAAGACCTTTCATTTAAGAAGGGTGAAAG
ATTTCAAATAATTAACAATACGGAAGGAGATTGGTGGGAAGCAAGATCAATCGCTACAGGAAAGAATGGT
TATATCCCGAGCAATTATGTAGCGCCTGCAGATTCCATTCAGGCAGAAGAATGGTATTTTGGCAAAATGG
GGAGAAAAGATGCTGAAAGATTACTTTTGAATCCTGGAAATCAACGAGGTATTTTCTTAGTAAGAGAGAG
TGAAACAACTAAAGGTGCTTATTCCCTTTCTATTCGTGATTGGGATGAGATAAGGGGTGACAATGTGAAA
CACTACAAAATTAGGAAACTTGACAATGGTGGATACTATATCACAACCAGAGCACAATTTGATACTCTGC
AGAAATTGGTGAAACACTACACAGAACATGCTGATGGTTTATGCCACAAGTTGACAACTGTGTGTCCAAC
TGTGAAACCTCAGACTCAAGGTCTAGCAAAAGATGCTTGGGAAATCCCTCGAGAATCTTTGCGACTAGAG
GTTAAACTAGGACAAGGATGTTTCGGCGAAGTGTGGATGGGAACATGGAATGGAACCACGAAAGTAGCAA
TCAAAACACTAAAACCAGGTACAATGATGCCAGAAGCTTTCCTTCAAGAAGCTCAGATAATGAAAAAATT
AAGACATGATAAACTTGTTCCACTATATGCTGTTGTTTCTGAAGAACCAATTTACATTGTCACTGAATTT
ATGTCAAAAGGAAGCTTATTAGATTTCCTTAAGGAAGGAGATGGAAAGTATTTGAAGCTTCCACAGCTGG
TTGATATGGCTGCTCAGATTGCTGATGGTATGGCATATATTGAAAGAATGAACTATATTCACCGAGATCT
TCGGGCTGCTAATATTCTTGTAGGAGAAAATCTTGTGTGCAAAATAGCAGACTTTGGTTTAGCAAGGTTA
ATTGAAGACAATGAATACACAGCAAGACAAGGTGCAAAATTTCCAATCAAATGGACAGCTCCTGAAGCTG
CACTGTATGGTCGGTTTACAATAAAGTCTGATGTCTGGTCATTTGGAATTCTGCAAACAGAACTAGTAAC
AAAGGGCCGAGTGCCATATCCAGGTATGGTGAACCGTGAAGTACTAGAACAAGTGGAGCGAGGATACAGG
ATGCCGTGCCCTCAGGGCTGTCCAGAATCCCTCCATGAATTGATGAATCTGTGTTGGAAGAAGGACCCTG
ATGAAAGACCAACATTTGAATATATTCAGTCCTTCTTGGAAGACTACTTCACTGCTACAGAGCCACAGTA
CCAGCCAGGAGAAAATTTATAA


>OriGene 5' read for mutant NM_005433 unedited
CCGCCGTTGAGCAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAAC
CGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGAAGTGACACGGACC
GGTCGCCTATCCTGACCACAGCAAAGCGGCCCGGAGCCCGCGGAGGGGACCTGACGGGGGCGTAGGCGCC
GGAAGGCTGGGGGCCCCGGAGCCGGGCCGGCGCGGCCCGAGTTCCGGTGAGCGGACGGCGGCGCGCGCAG
ATTTGATAATGGGCTGCATTAAAAGTAAAGAAAACAAAAGTCCAGCCATTAAATACAGACCTGAAAATAC
TCCCAGAGCCCTGTCAGTACAAGTGTGAGCCCATTATGGGAGCAGACCCCACTACAGTTGTCCACCATGT
CCCGTCATCCTTCAGCAAAGGGGAACAGCAGTTTAATTTTCAGCAGTTCTTTCCCATGACCACCATTTTG
GGAGGATCCTTCAGGGGTACCGCCCTTTTGGGAGGGTGCATTCTTCCTCATTTTTCAGGTGGGTGCAAGT
TTCTATATCCTCGTGGTTTAACCAGGTGGTGTACCATATTTTTGGCCCTAAATGATATATGAGCTAGAAC
CTACGAGAGACTTTTCTTTAGAAGGGTAAAGATTCCATATATTAACATCCGGAAGGAGATGGGGAACCGA
TCTACTCGCTAGGAAAATGGTATTCCAGACATTGTGACGCTCGCAATCCTTCGGCAAATGTTTGGCCAAT
GGAAAATGTCGAAATCTTGAATCCGGATCCAGGAATTCTGATAGAAAAGTGAAACTAAAGCCCTATCCTA
TACCCAGTGTGAATATGGGTTTACGTGAGAAAACACAATATGAGAT
>SC323601 kinase domain raw sequence. By performing BLASTX analysis with this sequence against NCBI refernce protein database, you can confirm the presence of the kinase-deficient mutation
CTGCATCCTCGAGATCTTTGCGACTAGAGGTTAAACTAGGACAAGGATGTTTCGGCGAAGTGTGGATGGG
AACATGGAATGGAACCACGAAAGTAGCAATCATGACACTAAAACCAGGTACAATGATGCCAGAAGCTTTC
CTTCAAGAAGCTCAGATAATGAAAAAATTAAGACATGATAAACTTGTTCCACTATATGCTGTTGTTTCTG
AAGAACCAATTTACATTGTCACTGAATTTATGTCAAAAGGAAGCT
Restriction Sites Please inquire     
ACCN NM_005433
Insert Size 4230 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This kinase-deficient mutant clone was generated by created by site-directed mutagenesis from the corresponding wild-type clone. See details in "Application of active and kinase-deficient kinome collection for identification of kinases regulating hedgehog signaling." Cell. 2008 May p536-548.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005433.3, NP_005424.1
RefSeq Size 4685 bp
RefSeq ORF 1632 bp
Locus ID 7525
UniProt ID P07947
Cytogenetics 18p11.32
Domains pkinase, SH2, TyrKc, SH3, S_TKc
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Adherens junction, Tight junction
Gene Summary This gene is the cellular homolog of the Yamaguchi sarcoma virus oncogene. The encoded protein has tyrosine kinase activity and belongs to the src family of proteins. This gene lies in close proximity to thymidylate synthase gene on chromosome 18, and a corresponding pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.