Snf1lk2 (SIK2) (NM_015191) Human Untagged Clone

CAT#: SC323400

Reviews ()
Write a review

SIK2 (untagged)-Kinase deficient mutant (K49M) of Human salt-inducible kinase 2 (SIK2)



  "NM_015191" in other vectors (7)

Reconstitution Protocol

USD 849.00

In Stock*

Size
    • 10 ug

Product images

Other products for "SIK2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SIK2
Synonyms LOH11CR1I; QIK; SIK-2; SNF1LK2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC323400 sequence for NM_015191 edited (data generated by NextGen Sequencing)
ATGGTCATGGCGGATGGCCCGAGGCACTTGCAGCGCGGGCCGGTCCGGGTGGGGTTCTAC
GACATCGAGGGCACGCTGGGCAAGGGCAACTTCGCTGTGGTGAAGCTGGGGCGGCACCGG
ATCACCAAGACGGAGGTGGCAATAATGATAATCGATAAGTCTCAGCTGGATGCAGTGAAC
CTTGAGAAAATCTACCGAGAAGTACAAATAATGAAAATGTTAGACCACCCTCACATAATC
AAACTTTATCAGGTAATGGAGACCAAAAGTATGTTGTACCTTGTGACAGAATATGCCAAA
AATGGAGAAATTTTTGACTATCTTGCTAATCATGGCCGGTTAAATGAGTCTGAAGCCAGG
CGAAAATTCTGGCAAATCCTGTCTGCTGTTGATTATTGTCATGGTCGGAAGATTGTGCAC
CGTGACCTCAAAGCTGAAAATCTCCTGCTGGATAACAACATGAATATCAAAATAGCAGAT
TTCGGTTTTGGAAATTTCTTTAAAAGTGGTGAACTGCTGGCAACATGGTGTGGCAGCCCC
CCTTATGCAGCCCCAGAAGTCTTTGAAGGGCAGCAGTATGAAGGACCACAGCTGGACATC
TGGAGTATGGGAGTTGTTCTTTATGTCCTTGTCTGTGGAGCTCTGCCCTTTGATGGACCG
ACTCTTCCAATTTTGAGGCAGAGGGTTCTGGAAGGAAGATTCCGGATTCCGTATTTCATG
TCAGAAGATTGCGAGCACCTTATCCGAAGGATGTTGGTCCTAGACCCATCCAAACGGCTA
ACCATAGCCCAAATCAAGGAGCATAAATGGATGCTCATAGAAGTTCCTGTCCAGAGACCT
GTTCTCTATCCACAAGAGCAAGAAAATGAGCCATCCATCGGGGAGTTTAATGAGCAGGTT
CTGCGACTGATGCACAGCCTTGGAATAGATCAGCAGAAAACCATTGAGTCTTTGCAGAAC
AAGAGCTATAACCACTTTGCTGCCATTTATTTCTTGTTGGTGGAGCGCCTGAAATCACAT
CGGAGCAGTTTCCCAGTGGAGCAGAGACTTGATGGCCGCCAGCGTCGGCCTAGCACCATT
GCTGAGCAAACAGTTGCCAAGGCACAGACTGTGGGGCTCCCAGTGACCATGCATTCACCG
AACATGAGGCTGCTGCGATCTGCCCTCCTCCCCCAGGCATCCAACGTGGAGGCCTTTTCA
TTTCCAGCATCTGGCTGTCAGGCGGAAGCTGCATTCATGGAAGAAGAGTGTGTGGACACT
CCAAAGGTCAATGGCTGTCTGCTTGACCCTGTGCCTCCTGTCCTGGTGCGGAAGGGATGC
CAGTCACTGCCCAGCAACATGATGGAGACCTCCATTGACGAAGGGCTGGAGACAGAAGGA
GAGGCCGAGGAAGACCCCGCTCATGCCTTTGAGGCATTTCAGTCCACACGCAGCGGGCAG
AGACGGCACACTCTGTCAGAAGTGACCAATCAACTGGTCGTGATGCCTGGGGCAGGGAAA
ATTTTCTCCATGAATGACAGCCCCTCCCTTGACAGTGTGGACTCTGAGTATGATATGGGG
TCTGTTCAGAGGGACCTGAACTTTCTGGAAGACAACCCTTCCCTTAAGGACATCATGTTA
GCCAATCAGCCTTCACCCCGCATGACATCTCCCTTCATAAGCCTGAGACCTACCAACCCA
GCCATGCAGGCTCTGAGCTCCCAGAAACGAGAGGTCCACAACAGGTCTCCAGTGAGCTTC
AGAGAGGGCCGCAGAGCATCAGATACCTCCCTCACCCAGGGAATTGTAGCATTTAGACAA
CATCTTCAGAATCTGGCTAGAACCAAAGGAATTCTAGAGTTGAACAAAGTGCAGTTGTTG
TATGAACAAATAGGACCGGAGGCAGACCCTAACCTGGCGCCGGCGGCTCCTCAGCTCCAG
GACCTTGCTAGCAGCTGCCCTCAGGAAGAAGTTTCTCAGCAGCAGGAAAGCGTCTCCACT
CTCCCTGCCAGCGTGCATCCCCAGCTGTCCCCACGGCAGAGCCTGGAGACCCAGTACCTG
CAGCACAGACTCCAGAAGCCCAGCCTTCTGTCAAAGGCCCAGAACACCTGTCAGCTTTAT
TGCAAAGAACCACCGCGGAGCCTTGAGCAGCAGCTGCAGGAACATAGGCTCCAGCAGAAG
CGACTCTTTCTTCAGAAGCAGTCTCAACTGCAGGCCTATTTTAATCAGATGCAGATAGCA
GAGAGCTCCTACCCACAGCCAAGTCAGCAGCTGCCCCTTCCCCGCCAGGAGACTCCACCG
CCTTCTCAGCAGGCCCCACCGTTCAGCCTGACCCAGCCCCTGAGCCCCGTCCTGGAGCCT
TCCTCCGAGCAGATGCAATACAGCCCTTTCCTCAGCCAGTACCAAGAGATGCAGCTTCAG
CCCCTGCCCTCCACTTCCGGTCCCCGGGCTGCTCCTCCTCTGCCCACGCAGCTACAGCAG
CAGCAGCCGCCACCGCCACCACCCCCTCCACCACCACGACAGCCAGGAGCTGCCCCAGCC
CCCTTACAGTTCTCCTATCAGACTTGTGAGCTGCCAAGCGCTGCTTCCCCTGCGCCAGAC
TATCCCACTCCCTGTCAGTATCCTGTGGATGGAGCCCAGCAGAGCGACCTAACGGGGCCA
GACTGTCCCAGAAGCCCAGGACTGCAAGAGGCCCCCTCCAGCTACGACCCACTAGCCCTC
TCTGAGCTACCTGGACTCTTTGATTGTGAAATGCTAGACGCTGTGGATCCACAACACAAC
GGGTATGTCCTGGTGAATTAG

Clone variation with respect to NM_015191.1
146 a=>t;147 a=>g
>OriGene 5' read for mutant NM_015191 unedited
CCCGCCGTTGTGCAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAA
CCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCGGCGGCGCGCGCC
TGGCTGGGCCCTGCGGAGCGGGAGGGAAGGAGCGAAGGAGCGAAGGAGCAAGCGGAGCGGCCGTCGCCCA
AGCCAAGCCGCGCTGCCAACCCTCCCGCCCGCCCGCGCTCCTGTCCGCCGTGTCTAGCAGCGGGGCCCAG
CATGGTCATGGCGGATGGCCCGAGGCACTTGCAGCGCGGGCCGGTCCGGGGTGGGGGTTCTACGACATCC
GAGGGGCACGCTTGGGCCAAGGGCAACTTCGCTGTGGTGGAAGCTGGGGCCGGGCACCCGAATCACCAAG
AACGGAAGGTGGGCAATAAGGATAATCATTAATTTCTAAGCTTGGATGCAGTGGAACCTGGGAAAAAACC
TACCGAAAAGACACAAATAAGGAAAAGTGTAAAACCCCCCCCTCATATATCAAATTTTTTCGGGAAGGGG
AAACCAAAGTTTTGGTTATCCCTTTGTGACGAAATTGCCCAAAAGGGGAAAATTTTTACAATACTGGGAA
ACCGGGCCGTTAAAAAGACTCAAAACCCAGGAAAAATTTGGGAAAACCCGGTCGGGTGAAATTGGGCCGG
GGGCAAAAAAATGGCCCCGGGACCCAAACTAAAAAATTCCGGGGGGATAACCACGGGAATATAAAAATAG
AATTTTGTGTTTGGGAAATTTTTTTAAAGGGGGGAACGCGGGGCACAGGGGGGGGGAGCCCCCCCTATTA
TGCCCCCAAATTTTTTTTTAGGGCGCACTTTAAAGACACACACCTGGCAGCTCGGGTGATGTGAGTGTTT
CTTATTACTGTCGTGGAGCGTCCTTCGATGGAGCACACATTCATTATTATTGCGAAGATATGTGAGACAG
AATGCGATGCCTGCTCATCATTGCTA
>SC323400 kinase domain raw sequence. By performing BLASTX analysis with this sequence against NCBI refernce protein database, you can confirm the presence of the kinase-deficient mutation
CCCTGMGCATGGGCGGTAGGCKGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAG
AATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCGGCGGCGCGCGCCTGGCTGG
GCCCTGCGGAGCGGGAGGGAAGGAGCGAAGGAGCGAAGGAGCAAGCGGAGCGGCCGTCGCCCAAGCCAAG
CCGCGCTGCCAACCCTCCCGCCCGCCCGCGCTCCTGTCCGCCGTG
Restriction Sites Please inquire     
ACCN NM_015191
Insert Size 4730 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This kinase-deficient mutant clone was generated by created by site-directed mutagenesis from the corresponding wild-type clone. See details in "Application of active and kinase-deficient kinome collection for identification of kinases regulating hedgehog signaling." Cell. 2008 May p536-548.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_015191.1, NP_056006.1
RefSeq Size 5694 bp
RefSeq ORF 2781 bp
Locus ID 23235
UniProt ID Q9H0K1
Cytogenetics 11q23.1
Protein Families Druggable Genome, Protein Kinase
Gene Summary Phosphorylates 'Ser-794' of IRS1 in insulin-stimulated adipocytes, potentially modulating the efficiency of insulin signal transduction. Inhibits CREB activity by phosphorylating and repressing TORCs, the CREB-specific coactivators.[UniProtKB/Swiss-Prot Function]

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.