MLX (NM_198204) Human Untagged Clone

CAT#: SC322389

MLX (untagged)-Human MAX-like protein X (MLX), transcript variant 2



  "NM_198204" in other vectors (5)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MLX
Synonyms bHLHd13; MAD7; MXD7; TCFL4; TF4
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_198204 edited
CGCCGCAGGGGGCCCGCCCGCTGGCCCGTTTCCGGTCCGGTGGGTACAAGATGACGGAGC
CGGGCGCCTCTCCCGAGGACCCTTGGGTCAAGGTGGAGTATGCCTACAGCGACAACAGCC
TGGACCCCGGGCTTTTTGTAGAAAGCACCCGCAAGGGGAGTGTAGTGTCCAGAGCTAATA
GCATCGGTTCCACCAGTGCCTCTTCTGTCCCCAACACAGATGATGAGGACAGTGATTACC
ACCAGGAGGCCTACAAGGAGTCCTACAAAGACCGGCGGCGGCGCGCACACACTCAGGCTG
AGCAGAAGAGGAGGGACGCCATCAAGAGAGGCTATGATGACCTTCAGACCATCGTCCCCA
CTTGCCAGCAGCAGGACTTCTCCATTGGCTCCCAAAAGCTCAGCAAAGCCATCGTTCTAC
AAAAGACCATTGACTACATTCAGTTTTTGCACAAGGAGAAGAAAAAGCAGGAGGAGGAGG
TGTCCACGTTACGCAAGGATGTCACCGCCCTAAAGATCATGAAAGTGAACTATGAGCAGA
TTGTGAAGGCACACCAGGACAACCCCCATGAAGGGGAGGACCAGGTCTCTGACCAGGTCA
AGTTCAACGTGTTTCAAGGCATCATGGATTCCCTGTTCCAGTCCTTCAATGCCTCCATCT
CAGTGGCCAGCTTCCAGGAGCTGTCAGCATGTGTCTTCAGCTGGATCGAGGAGCACTGTA
AGCCTCAGACCCTGCGGGAGATTGTGATTGGCGTCCTGCACCAATTGAAAAACCAGCTTT
ACTGACCGGTTCTTGGAAACCTGGAGAACAGCCAACAAGAGGCCCTTGAATCTCTACGTG
GCCACTGAACTGCTGGGCCCGGGAGACTGGACTACAACACCTCACACTGGTCAGCTGGTT
TCTACTTGGTGTTTGGTTTTTCCCAGCCCCATTTTATCTTCAGCGGAGCCGCGGTGTTTG
TTTTGTGAAAGCTTCTGATTAATTTATTATATTGACGATAAAACTCAAACCTACCCAGCC
TTCCCCCCACTCCATGGAAGTCCTTGGGATGGGCGTCTGCTCTGGACACCCCAAAGAGCT
CCTGCCCTCTCAGCCCTTTATTCAAGCCTCAGATTTCTGCTCATGATCTACATAGATTTG
GAAACTGTTTTCCTCTGTTTTGGTCTCTTGGGCAACATTTTTGGCCCAAGTTTGGGCAAC
ATTTGGCCCAAGTTTGGGCATTTTGGCAGTAGCTGTATGGGAGAAAAAGAGTAAGAGGAA
ATATTCCCACAGCCATGAAGGGTGAAAGGGCACCTTGTGCCTAGACTAGGGCTGCCTGGT
CAGTCCCAGGTGAGGCCAAGGGCTTTCTGGCCATCTCAGGGAGGGGCCACCAGGTTCCTC
CCCTCACCCCATATTCCATCACCTTCCTCCTCTGCTCTGGGTGGTAAGGGAAGCCCTCCT
GGTTCCCACAGGCTATGATGCTGCATGGCAGAGGCAGGTATAACACAGCACTACATATTG
GAAATTTTTTATTTTTCTAAATACCAATGCAGTTTTGCTACGGTTACAATTTTGAAATAT
TAACTGAGCCTCAAAATCACCCTTTCTGTCAAGCATATCTTGGCCTCTCCCATGTCTCAG
TGTTGCCTGCATTTCTCCCAGGACTTGGGGGTGGGGTGAAAAGCGTACAAAAGATACTTA
AAAGGGCTCCTGGGGTACACAAGCCCAGCAGGTCCTGAGTGAAGCCGTGGGCCCTCCAAA
TGCTCGTTTTATAGCAACCTCTCTCTACCCTAGTTCTCCAAATTCACTTCTGCCTTCCTC
AGGTTTGATATCTGGCAGGTTTGACTATCCAGAGGAAATTAAATATTTTTATATAAAATT
AAATTATAATAAATATTGCCAAATGCTTTCCTTTAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_198204
Insert Size 1900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_198204.1, NP_937847.1
RefSeq Size 2406 bp
RefSeq ORF 735 bp
Locus ID 6945
UniProt ID Q9UH92
Cytogenetics 17q21.2
Protein Families Druggable Genome, Transcription Factors
Gene Summary The product of this gene belongs to the family of basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factors. These factors form heterodimers with Mad proteins and play a role in proliferation, determination and differentiation. This gene product may act to diversify Mad family function by its restricted association with a subset of the Mad family of transcriptional repressors, namely, Mad1 and Mad4. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) contains an additional coding exon compared to variant 1. The resulting isoform (beta) thus, is longer than isoform alpha encoded by variant 1.

Other Versions

{0} Product Review(s)

0 Product Review(s)

Be the first one to submit a review

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.