BCA1 (CXCL13) (NM_006419) Human Untagged Clone
CAT#: SC321077
CXCL13 (untagged)-Human chemokine (C-X-C motif) ligand 13 (CXCL13)
"NM_006419" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BCA1 |
Synonyms | ANGIE; ANGIE2; BCA-1; BCA1; BLC; BLR1L; SCYB13 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>SC321077 representing NM_006419.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAGTTCATCTCGACATCTCTGCTTCTCATGCTGCTGGTCAGCAGCCTCTCTCCAGTCCAAGGTGTT CTGGAGGTCTATTACACAAGCTTGAGGTGTAGATGTGTCCAAGAGAGCTCAGTCTTTATCCCTAGACGC TTCATTGATCGAATTCAAATCTTGCCCCGTGGGAATGGTTGTCCAAGAAAAGAAATCATAGTCTGGAAG AAGAACAAGTCAATTGTGTGTGTGGACCCTCAAGCTGAATGGATACAAAGAATGATGGAAGTATTGAGA AAAAGAAGTTCTTCAACTCTACCAGTTCCAGTGTTTAAGAGAAAGATTCCCTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_006419 |
Insert Size | 330 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006419.2 |
RefSeq Size | 1219 bp |
RefSeq ORF | 330 bp |
Locus ID | 10563 |
UniProt ID | O43927 |
Cytogenetics | 4q21.1 |
Domains | IL8 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
MW | 12.7 kDa |
Gene Summary | B lymphocyte chemoattractant, independently cloned and named Angie, is an antimicrobial peptide and CXC chemokine strongly expressed in the follicles of the spleen, lymph nodes, and Peyer's patches. It preferentially promotes the migration of B lymphocytes (compared to T cells and macrophages), apparently by stimulating calcium influx into, and chemotaxis of, cells expressing Burkitt's lymphoma receptor 1 (BLR-1). It may therefore function in the homing of B lymphocytes to follicles. [provided by RefSeq, Oct 2014] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203102 | CXCL13 (Myc-DDK-tagged)-Human chemokine (C-X-C motif) ligand 13 (CXCL13) |
USD 150.00 |
|
RC203102L1 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 13 (CXCL13), Myc-DDK-tagged |
USD 450.00 |
|
RC203102L2 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 13 (CXCL13), mGFP tagged |
USD 450.00 |
|
RC203102L3 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 13 (CXCL13), Myc-DDK-tagged |
USD 450.00 |
|
RC203102L4 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 13 (CXCL13), mGFP tagged |
USD 450.00 |
|
RG203102 | CXCL13 (tGFP-tagged) - Human chemokine (C-X-C motif) ligand 13 (CXCL13) |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review