PPP1A(PPP1CA) (NM_002708) Human Untagged Clone

CAT#: SC319185

PPP1CA (untagged)-Human protein phosphatase 1, catalytic subunit, alpha isozyme (PPP1CA), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PPP1A(PPP1CA) (NM_002708) Human Untagged Clone
Symbol PPP1CA
Synonyms PP-1A; PP1A; PP1alpha; PPP1A
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002708.3 GGCTGCCGGAGGGCGGGAGGCAGGAGCGGGCCAGGAGCTGCTGGGCTGGAGCGGCGGCGC
CGCCATGTCCGACAGCGAGAAGCTCAACCTGGACTCGATCATCGGGCGCCTGCTGGAAGT
GCAGGGCTCGCGGCCTGGCAAGAATGTACAGCTGACAGAGAACGAGATCCGCGGTCTGTG
CCTGAAATCCCGGGAGATTTTTCTGAGCCAGCCCATTCTTCTGGAGCTGGAGGCACCCCT
CAAGATCTGCGGTGACATACACGGCCAGTACTACGACCTTCTGCGACTATTTGAGTATGG
CGGTTTCCCTCCCGAGAGCAACTACCTCTTTCTGGGGGACTATGTGGACAGGGGCAAGCA
GTCCTTGGAGACCATCTGCCTGCTGCTGGCCTATAAGATCAAGTACCCCGAGAACTTCTT
CCTGCTCCGTGGGAACCACGAGTGTGCCAGCATCAACCGCATCTATGGTTTCTACGATGA
GTGCAAGAGACGCTACAACATCAAACTGTGGAAAACCTTCACTGACTGCTTCAACTGCCT
GCCCATCGCGGCCATAGTGGACGAAAAGATCTTCTGCTGCCACGGAGGCCTGTCCCCGGA
CCTGCAGTCTATGGAGCAGATTCGGCGGATCATGCGGCCCACAGATGTGCCTGACCAGGG
CCTGCTGTGTGACCTGCTGTGGTCTGACCCTGACAAGGACGTGCAGGGCTGGGGCGAGAA
CGACCGTGGCGTCTCTTTTACCTTTGGAGCCGAGGTGGTGGCCAAGTTCCTCCACAAGCA
CGACTTGGACCTCATCTGCCGAGCACACCAGGTGGTAGAAGACGGCTACGAGTTCTTTGC
CAAGCGGCAGCTGGTGACACTTTTCTCAGCTCCCAACTACTGTGGCGAGTTTGACAATGC
TGGCGCCATGATGAGTGTGGACGAGACCCTCATGTGCTCTTTCCAGATCCTCAAGCCCGC
CGACAAGAACAAGGGGAAGTACGGGCAGTTCAGTGGCCTGAACCCTGGAGGCCGACCCAT
CACCCCACCCCGCAATTCCGCCAAAGCCAAGAAATAGCCCCCGCACACCACCCTGTGCCC
CAGATGATGGATTGATTGTACAGAAATCATGCTGCCATGCTGGGGGGGGGTCACCCCGAC
CCCTCAGGCCCACCTGTCACGGGGAACATGGAGCCTTGGTGTATTTTTCTTTTCTTTTTT
TAATGAATCAATAGCAGCGTCCAGTCCCCCAGGGCTGCTTCCTGCCTGCACCTGCGGTGA
CTGTGAGCAGGATCCTGGGGCCGAGGCTGCAGCTCAGGGCAACGGCAGGCCAGGTCGTGG
GTCTCCAGCCGTGCTTGGCCTCAGGGCTGGCAGCCGGATCCTGGGGCAACCCATCTGGTC
TCTTGAATAAAGGTCAAAGCTGGATTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002708.3 unedited
GACACTTTGTTATACGACTCCTATAGGGCGGCCGGGAATTCGGCACGAGGGGCTGCCGGA
GGGCGGGAGGCAGGAGCGGGCCAGGAGCTGCTGGGCTGGAGCGGCGGCGCCGCCATGTCC
GACAGCGAGAAGCTCAACCTGGACTCGATCATCGGGCGCCTGCTGGAAGTGCAGGGCTCG
CGGCCTGGCAAGAATGTACAGCTGACAGAGAACGAGATCCGCGGTCTGTGCCTGAAATCC
CGGGAGATTTTTCTGAGCCAGCCCATTCTTCTGGAGCTGGAGGCACCCCTCAAGATCTGC
GGTGACATACACGGCCAGTACTACGACCTTCTGCGACTATTTGAGTATGGCGGTTTCCCT
CCCGAGAGCAACTACCTCTTTCTGGGGGACTATGTGGACAGGGGCAAGCAGTCCTTGGAG
ACCATCTGCCTGCTGCTGGCCTATAAGATCAAGTACCCCGAGAACTTCTTCCTGCTCCGT
GGGAACCACGAGTGTGCCAGCATCAACCGCATCTATGGTTTCTACGATGAGTGCAAGAGA
CGCTACAACATCAAACTGTGGAAAACCTTCACTGACTGCTTCAACTGCCTGCCCATCGCG
GCCATAGTGGACGAAAAGATCTTCTGCTGCCACGGAGGCCTGTCCCCGGACCTGCAGTCT
ATGGAGCAGATTCGGCGGATCATGCGGCCCACAGATGTGCCTGACCAGGGCCTGCTGTGT
GACCTGCTGTGGTCTGACCCTGACAAGGACGTGCAGGGCTGGGGCGAGAACGACCGTGGC
GTCTCTTTACCTTTGGAGCCGAGTGGTGGCCAAGTTCCTCCACAAGCACGACTTGACCTC
ATCTGCCGAGCCACACCAGTGTAGAGACGCTACGAGTTCTTTGCCAAGCGCAGCTGTGAC
ACTTTTTCTCAGCTCCACTACTTGTGGGCGAGTTGACAATGCTGCGCCATGAATAGAA
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_002708
ORF Size 993 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002708.3, NP_002699
RefSeq Size 1488
Locus ID 5499
Cytogenetics 11q13.2
Domains Metallophos, PP2Ac
Protein Families Phosphatase, Druggable Genome
Protein Pathways Oocyte meiosis, Vascular smooth muscle contraction, Focal adhesion, Long-term potentiation, Regulation of actin cytoskeleton, Insulin signaling pathway
Gene Summary The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Increased PP1 activity has been observed in the end stage of heart failure. Studies in both human and mice suggest that PP1 is an important regulator of cardiac function. Mouse studies also suggest that PP1 functions as a suppressor of learning and memory. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the predominant transcript and encodes isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations