Angiopoietin 2(ANGPT2) (NM_001118888) Human Untagged Clone

CAT#: SC318881

ANGPT2 (untagged)-Human angiopoietin 2 (ANGPT2), transcript variant 3

USD 711


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Angiopoietin 2(ANGPT2) (NM_001118888) Human Untagged Clone
Symbol ANGPT2
Synonyms AGPT2; ANG2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001118888 edited
ATGTGGCAGATTGTTTTCTTTACTCTGAGCTGTGATCTTGTCTTGGCCGCAGCCTATAAC
AACTTTCGGAAGAGCATGGACAGCATAGGAAAGAAGCAATATCAGGTCCAGCATGGGTCC
TGCAGCTACACTTTCCTCCTGCCAGAGATGGACAACTGCCGCTCTTCCTCCAGCCCCTAC
GTGTCCAATGCTGTGCAGAGGGACGCGCCGCTCGAATACGATGACTCGGTGCAGAGGCTG
CAAGTGCTGGAGAACATCATGGAAAACAACACTCAGTGGCTAATGAAGGTATTAAATCAG
ACCACGAGACTTGAACTTCAGCTCTTGGAACACTCCCTCTCGACAAACAAATTGGAAAAA
CAGATTTTGGACCAGACCAGTGAAATAAACAAATTGCAAGATAAGAACAGTTTCCTAGAA
AAGAAGGTGCTAGCTATGGAAGACAAGCACATCATCCAACTACAGTCAATAAAAGAAGAG
AAAGATCAGCTACAGGTGTTAGTATCCAAGCAAAATTCCATCATTGAAGAACTAGAAAAA
AAAATAGTGACTGCCACGGTGAATAATTCAGTTCTTCAGAAGCAGCAACATGATCTCATG
GAGACAGTTAATAACTTACTGACTATGATGTCCACATCAAACTCTAAGGACCCCACTGTT
GCTAAAGAAGAACAAATCAGCTTCAGAGACTGTGCTGAAGTATTCAAATCAGGACACACC
ACGAATGGCATCTACACGTTAACATTCCCTAATTCTACAGAAGAGATCAAGGCCTACTGT
GACATGGAAGCTGGAGGAGGCGGGTGGACAATTATTCAGCGACGTGAGGATGGCAGCGTT
GATTTTCAGAGGACTTGGAAAGAATATAAAGTGGGATTTGGTAACCCTTCAGGAGAATAT
TGGCTGGGAAATGAGTTTGTTTCGCAACTGACTAATCAGCAACGCTATGTGCTTAAAATA
CACCTTAAAGACTGGGAAGGGAATGAGGCTTACTCATTGTATGAACATTTCTATCTCTCA
AGTGAAGAACTCAATTATAGGATTCACCTTAAAGGACTTACAGGGACAGCCGGCAAAATA
AGCAGCATCAGCCAACCAGGAAATGATTTTAGCACAAAGGATGGAGACAACGACAAATGT
ATTTGCAAATGTTCACAAATGCTAACAGGAGGCTGGTGGTTTGATGCATGTGGTCCTTCC
AACTTGAACGGAATGTACTATCCACAGAGGCAGAACACAAATAAGTTCAACGGCATTAAA
TGGTACTACTGGAAAGGCTCAGGCTATTCGCTCAAGGCCACAACCATGATGATCCGACCA
GCAGATTTCTAA
Tag Tag Free
ACCN NM_001118888
ORF Size 1335 bp
Insert Size 5000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001118888.1, NP_001112360
RefSeq Size 5114
RefSeq ORF 1335
Locus ID 285
Cytogenetics 8p23.1
Protein Families Secreted Protein, Druggable Genome
Gene Summary The protein encoded by this gene is an antagonist of angiopoietin 1 (ANGPT1) and endothelial TEK tyrosine kinase (TIE-2, TEK). The encoded protein disrupts the vascular remodeling ability of ANGPT1 and may induce endothelial cell apoptosis. Three transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1, resulting in an isoform (c) that has the same N- and C-termini but is shorter compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.