Angiopoietin 2 (ANGPT2) (NM_001118888) Human Untagged Clone

SKU
SC318881
ANGPT2 (untagged)-Human angiopoietin 2 (ANGPT2), transcript variant 3
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Angiopoietin 2
Synonyms AGPT2; ANG2; LMPHM10
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001118888 edited
ATGTGGCAGATTGTTTTCTTTACTCTGAGCTGTGATCTTGTCTTGGCCGCAGCCTATAAC
AACTTTCGGAAGAGCATGGACAGCATAGGAAAGAAGCAATATCAGGTCCAGCATGGGTCC
TGCAGCTACACTTTCCTCCTGCCAGAGATGGACAACTGCCGCTCTTCCTCCAGCCCCTAC
GTGTCCAATGCTGTGCAGAGGGACGCGCCGCTCGAATACGATGACTCGGTGCAGAGGCTG
CAAGTGCTGGAGAACATCATGGAAAACAACACTCAGTGGCTAATGAAGGTATTAAATCAG
ACCACGAGACTTGAACTTCAGCTCTTGGAACACTCCCTCTCGACAAACAAATTGGAAAAA
CAGATTTTGGACCAGACCAGTGAAATAAACAAATTGCAAGATAAGAACAGTTTCCTAGAA
AAGAAGGTGCTAGCTATGGAAGACAAGCACATCATCCAACTACAGTCAATAAAAGAAGAG
AAAGATCAGCTACAGGTGTTAGTATCCAAGCAAAATTCCATCATTGAAGAACTAGAAAAA
AAAATAGTGACTGCCACGGTGAATAATTCAGTTCTTCAGAAGCAGCAACATGATCTCATG
GAGACAGTTAATAACTTACTGACTATGATGTCCACATCAAACTCTAAGGACCCCACTGTT
GCTAAAGAAGAACAAATCAGCTTCAGAGACTGTGCTGAAGTATTCAAATCAGGACACACC
ACGAATGGCATCTACACGTTAACATTCCCTAATTCTACAGAAGAGATCAAGGCCTACTGT
GACATGGAAGCTGGAGGAGGCGGGTGGACAATTATTCAGCGACGTGAGGATGGCAGCGTT
GATTTTCAGAGGACTTGGAAAGAATATAAAGTGGGATTTGGTAACCCTTCAGGAGAATAT
TGGCTGGGAAATGAGTTTGTTTCGCAACTGACTAATCAGCAACGCTATGTGCTTAAAATA
CACCTTAAAGACTGGGAAGGGAATGAGGCTTACTCATTGTATGAACATTTCTATCTCTCA
AGTGAAGAACTCAATTATAGGATTCACCTTAAAGGACTTACAGGGACAGCCGGCAAAATA
AGCAGCATCAGCCAACCAGGAAATGATTTTAGCACAAAGGATGGAGACAACGACAAATGT
ATTTGCAAATGTTCACAAATGCTAACAGGAGGCTGGTGGTTTGATGCATGTGGTCCTTCC
AACTTGAACGGAATGTACTATCCACAGAGGCAGAACACAAATAAGTTCAACGGCATTAAA
TGGTACTACTGGAAAGGCTCAGGCTATTCGCTCAAGGCCACAACCATGATGATCCGACCA
GCAGATTTCTAA
Restriction Sites Please inquire
ACCN NM_001118888
Insert Size 5000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001118888.1, NP_001112360.1
RefSeq Size 5114 bp
RefSeq ORF 1335 bp
Locus ID 285
UniProt ID O15123
Cytogenetics 8p23.1
Protein Families Druggable Genome, Secreted Protein
Summary This gene belongs to the angiopoietin family of growth factors. The protein encoded by this gene is an antagonist of angiopoietin 1, and both angiopoietin 1 and angiopoietin 2 are ligands for the endothelial TEK receptor tyrosine kinase. Angiopoietin 2 is upregulated in multiple inflammatory diseases and is implicated in the direct control of inflammation-related signaling pathways. The encoded protein affects angiogenesis during embryogenesis and tumorigenesis, disrupts the vascular remodeling ability of angiopoietin 1, and may induce endothelial cell apoptosis. This gene serves a prognostic biomarker for acute respiratory distress syndrome. [provided by RefSeq, Aug 2020]
Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1, resulting in an isoform (c) that has the same N- and C-termini but is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
Write Your Own Review
You're reviewing:Angiopoietin 2 (ANGPT2) (NM_001118888) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225727 ANGPT2 (Myc-DDK-tagged)-Human angiopoietin 2 (ANGPT2), transcript variant 3 10 ug
$457.00
RC225727L3 Lenti ORF clone of Human angiopoietin 2 (ANGPT2), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC225727L4 Lenti ORF clone of Human angiopoietin 2 (ANGPT2), transcript variant 3, mGFP tagged 10 ug
$757.00
RG225727 ANGPT2 (tGFP-tagged) - Human angiopoietin 2 (ANGPT2), transcript variant 3 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.