RSPO2 (NM_178565) Human Untagged Clone

SKU
SC317347
RSPO2 (untagged)-Human R-spondin 2 homolog (Xenopus laevis) (RSPO2)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RSPO2
Synonyms CRISTIN2; HHRRD; TETAMS2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_178565 edited
ATGCAGTTTCGCCTTTTCTCCTTTGCCCTCATCATTCTGAACTGCATGGATTACAGCCAC
TGCCAAGGCAACCGATGGAGACGCAGTAAGCGAGCTAGTTATGTATCAAATCCCATTTGC
AAGGGTTGTTTGTCTTGTTCAAAGGACAATGGGTGTAGCCGATGTCAACAGAAGTTGTTC
TTCTTCCTTCGAAGAGAAGGGATGCGCCAGTATGGAGAGTGCCTGCATTCCTGCCCATCC
GGGTACTATGGACACCGAGCCCCAGATATGAACAGATGTGCAAGATGCAGAATAGAAAAC
TGTGATTCTTGCTTTAGCAAAGACTTTTGTACCAAGTGCAAAGTAGGCTTTTATTTGCAT
AGAGGCCGTTGCTTTGATGAATGTCCAGATGGTTTTGCACCATTAGAAGAAACCATGGAA
TGTGTGGAAGGATGTGAAGTTGGTCATTGGAGCGAATGGGGAACTTGTAGCAGAAATAAT
CGCACATGTGGATTTAAATGGGGTCTGGAAACCAGAACACGGCAAATTGTTAAAAAGCCA
GTGAAAGACACAATACCGTGTCCAACCATTGCTGAATCCAGGAGATGCAAGATGACAATG
AGGCATTGTCCAGGAGGGAAGAGAACACCAAAGGCGAAGGAGAAGAGGAACAAGAAAAAG
AAAAGGAAGCTGATAGAAAGGGCCCAGGAGCAACACAGCGTCTTCCTAGCTACAGACAGA
GCTAACCAATAA
Restriction Sites Please inquire
ACCN NM_178565
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_178565.3.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_178565.3, NP_848660.2
RefSeq Size 2842 bp
RefSeq ORF 732 bp
Locus ID 340419
UniProt ID Q6UXX9
Cytogenetics 8q23.1
Protein Families Secreted Protein
Summary This gene encodes a member of the R-spondin family of proteins. These proteins are secreted ligands of leucine-rich repeat containing G protein-coupled receptors that enhance Wnt signaling through the inhibition of ubiquitin E3 ligases. A chromosomal translocation including this locus that results in the formation of a gene fusion has been identified in multiple human cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
Write Your Own Review
You're reviewing:RSPO2 (NM_178565) Human Untagged Clone
Your Rating
SKU Description Size Price
RC224177 RSPO2 (Myc-DDK-tagged)-Human R-spondin 2 homolog (Xenopus laevis) (RSPO2) 10 ug
$300.00
RC224177L1 Lenti ORF clone of Human R-spondin 2 homolog (Xenopus laevis) (RSPO2), Myc-DDK-tagged 10 ug
$600.00
RC224177L2 Lenti ORF clone of Human R-spondin 2 homolog (Xenopus laevis) (RSPO2), mGFP tagged 10 ug
$600.00
RC224177L3 Lenti ORF clone of Human R-spondin 2 homolog (Xenopus laevis) (RSPO2), Myc-DDK-tagged 10 ug
$600.00
RC224177L4 Lenti ORF clone of Human R-spondin 2 homolog (Xenopus laevis) (RSPO2), mGFP tagged 10 ug
$600.00
RG224177 RSPO2 (tGFP-tagged) - Human R-spondin 2 homolog (Xenopus laevis) (RSPO2) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC123361 RSPO2 (untagged)-Human R-spondin 2 homolog (Xenopus laevis) (RSPO2) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.