GNRHR (NM_000406) Human Untagged Clone
CAT#: SC316990
GNRHR (untagged)-Human gonadotropin-releasing hormone receptor (GNRHR), transcript variant 1
"NM_000406" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GNRHR |
Synonyms | GNRHR1; GRHR; HH7; LHRHR; LRHR |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF within SC316990 sequence for NM_000406 edited (data generated by NextGen Sequencing)
ATGGCAAACAGTGCCTCTCCTGAACAGAATCAAAATCACTGTTCAGCCATCAACAACAGC ATCCCACTGATGCAGGGCAACCTCCCCACTCTGACCTTGTCTGGAAAGATCCGAGTGACG GTTACTTTCTTCCTTTTTCTGCTCTCTGCGACCTTTAATGCTTCTTTCTTGTTGAAACTT CAGAAGTGGACACAGAAGAAAGAGAAAGGGAAAAAGCTCTCAAGAATGAAGCTGCTCTTA AAACATCTGACCTTAGCCAACCTGTTGGAGACTCTGATTGTCATGCCACTGGATGGGATG TGGAACATTACAGTCCAATGGTATGCTGGAGAGTTACTCTGCAAAGTTCTCAGTTATCTA AAGCTTTTCTCCATGTATGCCCCAGCCTTCATGATGGTGGTGATCAGCCTGGACCGCTCC CTGGCTATCACGAGGCCCCTAGCTTTGAAAAGCAACAGCAAAGTCGGACAGTCCATGGTT GGCCTGGCCTGGATCCTCAGTAGTGTCTTTGCAGGACCACAGTTATACATCTTCAGGATG ATTCATCTAGCAGACAGCTCTGGACAGACAAAAGTTTTCTCTCAATGTGTAACACACTGC AGTTTTTCACAATGGTGGCATCAAGCATTTTATAACTTTTTCACCTTCAGCTGCCTCTTC ATCATCCCTCTTTTCATCATGCTGATCTGCAATGCAAAAATCATCTTCACCCTGACACGG GTCCTTCATCAGGACCCCCACGAACTACAACTGAATCAGTCCAAGAACAATATACCAAGA GCACGGCTGAAGACTCTAAAAATGACGGTTGCATTTGCCACTTCATTTACTGTCTGCTGG ACTCCCTACTATGTCCTAGGAATTTGGTATTGGTTTGATCCTGAAATGTTAAACAGGTTG TCAGACCCAGTAAATCACTTCTTCTTTCTCTTTGCCTTTTTAAACCCATGCTTTGATCCA CTTATCTATGGATATTTTTCTCTGTGA Clone variation with respect to NM_000406.2 |
Restriction Sites | Please inquire |
ACCN | NM_000406 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000406.2, NP_000397.1 |
RefSeq Size | 5843 bp |
RefSeq ORF | 987 bp |
Locus ID | 2798 |
UniProt ID | P30968 |
Cytogenetics | 4q13.2 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | GnRH signaling pathway, Neuroactive ligand-receptor interaction |
Gene Summary | This gene encodes the receptor for type 1 gonadotropin-releasing hormone. This receptor is a member of the seven-transmembrane, G-protein coupled receptor (GPCR) family. It is expressed on the surface of pituitary gonadotrope cells as well as lymphocytes, breast, ovary, and prostate. Following binding of gonadotropin-releasing hormone, the receptor associates with G-proteins that activate a phosphatidylinositol-calcium second messenger system. Activation of the receptor ultimately causes the release of gonadotropic luteinizing hormone (LH) and follicle stimulating hormone (FSH). Defects in this gene are a cause of hypogonadotropic hypogonadism (HH). Alternative splicing results in multiple transcript variants encoding different isoforms. More than 18 transcription initiation sites in the 5' region and multiple polyA signals in the 3' region have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214403 | GNRHR (Myc-DDK-tagged)-Human gonadotropin-releasing hormone receptor (GNRHR), transcript variant 1 |
USD 300.00 |
|
RC214403L1 | Lenti ORF clone of Human gonadotropin-releasing hormone receptor (GNRHR), transcript variant 1, Myc-DDK-tagged |
USD 600.00 |
|
RC214403L2 | Lenti ORF clone of Human gonadotropin-releasing hormone receptor (GNRHR), transcript variant 1, mGFP tagged |
USD 600.00 |
|
RC214403L3 | Lenti ORF clone of Human gonadotropin-releasing hormone receptor (GNRHR), transcript variant 1, Myc-DDK-tagged |
USD 600.00 |
|
RC214403L4 | Lenti ORF clone of Human gonadotropin-releasing hormone receptor (GNRHR), transcript variant 1, mGFP tagged |
USD 600.00 |
|
RG214403 | GNRHR (tGFP-tagged) - Human gonadotropin-releasing hormone receptor (GNRHR), transcript variant 1 |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review