GNRHR (NM_000406) Human Untagged Clone

SKU
SC316990
GNRHR (untagged)-Human gonadotropin-releasing hormone receptor (GNRHR), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GNRHR
Synonyms GNRHR1; GRHR; HH7; LHRHR; LRHR
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC316990 sequence for NM_000406 edited (data generated by NextGen Sequencing)
ATGGCAAACAGTGCCTCTCCTGAACAGAATCAAAATCACTGTTCAGCCATCAACAACAGC
ATCCCACTGATGCAGGGCAACCTCCCCACTCTGACCTTGTCTGGAAAGATCCGAGTGACG
GTTACTTTCTTCCTTTTTCTGCTCTCTGCGACCTTTAATGCTTCTTTCTTGTTGAAACTT
CAGAAGTGGACACAGAAGAAAGAGAAAGGGAAAAAGCTCTCAAGAATGAAGCTGCTCTTA
AAACATCTGACCTTAGCCAACCTGTTGGAGACTCTGATTGTCATGCCACTGGATGGGATG
TGGAACATTACAGTCCAATGGTATGCTGGAGAGTTACTCTGCAAAGTTCTCAGTTATCTA
AAGCTTTTCTCCATGTATGCCCCAGCCTTCATGATGGTGGTGATCAGCCTGGACCGCTCC
CTGGCTATCACGAGGCCCCTAGCTTTGAAAAGCAACAGCAAAGTCGGACAGTCCATGGTT
GGCCTGGCCTGGATCCTCAGTAGTGTCTTTGCAGGACCACAGTTATACATCTTCAGGATG
ATTCATCTAGCAGACAGCTCTGGACAGACAAAAGTTTTCTCTCAATGTGTAACACACTGC
AGTTTTTCACAATGGTGGCATCAAGCATTTTATAACTTTTTCACCTTCAGCTGCCTCTTC
ATCATCCCTCTTTTCATCATGCTGATCTGCAATGCAAAAATCATCTTCACCCTGACACGG
GTCCTTCATCAGGACCCCCACGAACTACAACTGAATCAGTCCAAGAACAATATACCAAGA
GCACGGCTGAAGACTCTAAAAATGACGGTTGCATTTGCCACTTCATTTACTGTCTGCTGG
ACTCCCTACTATGTCCTAGGAATTTGGTATTGGTTTGATCCTGAAATGTTAAACAGGTTG
TCAGACCCAGTAAATCACTTCTTCTTTCTCTTTGCCTTTTTAAACCCATGCTTTGATCCA
CTTATCTATGGATATTTTTCTCTGTGA

Clone variation with respect to NM_000406.2
Restriction Sites Please inquire
ACCN NM_000406
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000406.2, NP_000397.1
RefSeq Size 5843 bp
RefSeq ORF 987 bp
Locus ID 2798
UniProt ID P30968
Cytogenetics 4q13.2
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways GnRH signaling pathway, Neuroactive ligand-receptor interaction
Summary This gene encodes the receptor for type 1 gonadotropin-releasing hormone. This receptor is a member of the seven-transmembrane, G-protein coupled receptor (GPCR) family. It is expressed on the surface of pituitary gonadotrope cells as well as lymphocytes, breast, ovary, and prostate. Following binding of gonadotropin-releasing hormone, the receptor associates with G-proteins that activate a phosphatidylinositol-calcium second messenger system. Activation of the receptor ultimately causes the release of gonadotropic luteinizing hormone (LH) and follicle stimulating hormone (FSH). Defects in this gene are a cause of hypogonadotropic hypogonadism (HH). Alternative splicing results in multiple transcript variants encoding different isoforms. More than 18 transcription initiation sites in the 5' region and multiple polyA signals in the 3' region have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Write Your Own Review
You're reviewing:GNRHR (NM_000406) Human Untagged Clone
Your Rating
SKU Description Size Price
RC214403 GNRHR (Myc-DDK-tagged)-Human gonadotropin-releasing hormone receptor (GNRHR), transcript variant 1 10 ug
$300.00
RC214403L1 Lenti ORF clone of Human gonadotropin-releasing hormone receptor (GNRHR), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC214403L2 Lenti ORF clone of Human gonadotropin-releasing hormone receptor (GNRHR), transcript variant 1, mGFP tagged 10 ug
$600.00
RC214403L3 Lenti ORF clone of Human gonadotropin-releasing hormone receptor (GNRHR), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC214403L4 Lenti ORF clone of Human gonadotropin-releasing hormone receptor (GNRHR), transcript variant 1, mGFP tagged 10 ug
$600.00
RG214403 GNRHR (tGFP-tagged) - Human gonadotropin-releasing hormone receptor (GNRHR), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.