HLAF (HLA-F) (NM_001098479) Human Untagged Clone

CAT#: SC316374

HLA (untagged)-Human major histocompatibility complex, class I, F (HLA-F), transcript variant 1


  "NM_001098479" in other vectors (6)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal Anti-HLA-F Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "HLAF"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HLAF
Synonyms CDA12; HLA-5.4; HLA-CDA12; HLAF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316374 representing NM_001098479.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCCCCGAAGCCTCCTCCTGCTGCTCTCAGGGGCCCTGGCCCTGACCGATACTTGGGCGGGCTCC
CACTCCTTGAGGTATTTCAGCACCGCTGTGTCGCGGCCCGGCCGCGGGGAGCCCCGCTACATCGCCGTG
GAGTACGTAGACGACACGCAATTCCTGCGGTTCGACAGCGACGCCGCGATTCCGAGGATGGAGCCGCGG
GAGCCGTGGGTGGAGCAAGAGGGGCCGCAGTATTGGGAGTGGACCACAGGGTACGCCAAGGCCAACGCA
CAGACTGACCGAGTGGCCCTGAGGAACCTGCTCCGCCGCTACAACCAGAGCGAGGCTGGGTCTCACACC
CTCCAGGGAATGAATGGCTGCGACATGGGGCCCGACGGACGCCTCCTCCGCGGGTATCACCAGCACGCG
TACGACGGCAAGGATTACATCTCCCTGAACGAGGACCTGCGCTCCTGGACCGCGGCGGACACCGTGGCT
CAGATCACCCAGCGCTTCTATGAGGCAGAGGAATATGCAGAGGAGTTCAGGACCTACCTGGAGGGCGAG
TGCCTGGAGTTGCTCCGCAGATACTTGGAGAATGGGAAGGAGACGCTACAGCGCGCAGATCCTCCAAAG
GCACACGTTGCCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTAC
CCTGCGGAGATCACGCTGACCTGGCAGCGGGATGGGGAGGAACAGACCCAGGACACAGAGCTTGTGGAG
ACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCCGCTGTGGTGGTGCCTCCTGGAGAGGAACAG
AGATACACATGCCATGTGCAGCACGAGGGGCTGCCCCAGCCCCTCATCCTGAGATGGGAGCAGTCTCCC
CAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTTGTTGTCCTTGGAGCTGTGGTCACTGGAGCT
GTGGTCGCTGCTGTGATGTGGAGGAAGAAGAGCTCAGATAGAAACAGAGGGAGCTACTCTCAGGCTGCA
GCCTACTCAGTGGTCAGCGGAAACTTGATGATAACATGGTGGTCAAGCTTATTTCTCCTGGGGGTGCTC
TTCCAAGGATATTTGGGCTGCCTCCGGAGTCACAGTGTCTTGGGCCGCCGGAAGGTGGGTGACATGTGG
ATCTTGTTTTTTTTGTGGCTGTGGACATCTTTCAACACTGCCTTCTTGGCCTTGCAAAGCCTTCGCTTT
GGCTTCGGCTTTAGGAGGGGCAGGAGCTTCCTTCTTCGTTCTTGGCACCATCTTATGAAAAGGGTCCAG
ATTAAGATTTTTGACTGA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001098479
Insert Size 1329 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001098479.1
RefSeq Size 1591 bp
RefSeq ORF 1329 bp
Locus ID 3134
UniProt ID P30511
Cytogenetics 6p22.1
Protein Families Transmembrane
Protein Pathways Allograft rejection, Antigen processing and presentation, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Endocytosis, Graft-versus-host disease, Type I diabetes mellitus, Viral myocarditis
MW 50.4 kDa
Gene Summary This gene belongs to the HLA class I heavy chain paralogues. It encodes a non-classical heavy chain that forms a heterodimer with a beta-2 microglobulin light chain, with the heavy chain anchored in the membrane. Unlike most other HLA heavy chains, this molecule is localized in the endoplasmic reticulum and Golgi apparatus, with a small amount present at the cell surface in some cell types. It contains a divergent peptide-binding groove, and is thought to bind a restricted subset of peptides for immune presentation. This gene exhibits few polymorphisms. Multiple transcript variants encoding different isoforms have been found for this gene. These variants lack a coding exon found in transcripts from other HLA paralogues due to an altered splice acceptor site, resulting in a shorter cytoplasmic domain. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest protein (isoform 1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.