JAK2 (NM_004972) Human Untagged Clone

CAT#: SC316317

JAK2 (untagged)-Human Janus kinase 2 (JAK2)

USD 2,163


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name JAK2 (NM_004972) Human Untagged Clone
Symbol JAK2
Synonyms JTK10; THCYT3
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC316317 sequence for NM_004972 edited (data generated by NextGen Sequencing)
ATGGGAATGGCCTGCCTTACGATGACAGAAATGGAGGGAACATCCACCTCTTCTATATAT
CAGAATGGTGATATTTCTGGAAATGCCAATTCTATGAAGCAAATAGATCCAGTTCTTCAG
GTGTATCTTTACCATTCCCTTGGGAAATCTGAGGCAGATTATCTGACCTTTCCATCTGGG
GAGTATGTTGCAGAAGAAATCTGTATTGCTGCTTCTAAAGCTTGTGGTATCACACCTGTG
TATCATAATATGTTTGCTTTAATGAGTGAAACAGAAAGGATCTGGTATCCACCCAACCAT
GTCTTCCATATAGATGAGTCAACCAGGCATAATGTACTCTACAGAATAAGATTTTACTTT
CCTCGTTGGTATTGCAGTGGCAGCAACAGAGCCTATCGGCATGGAATATCTCGAGGTGCT
GAAGCTCCTCTTCTTGATGACTTTGTCATGTCTTACCTCTTTGCTCAGTGGCGGCATGAT
TTTGTGCACGGATGGATAAAAGTACCTGTGACTCATGAAACACAGGAAGAATGTCTTGGG
ATGGCAGTGTTAGATATGATGAGAATAGCCAAAGAAAACGATCAAACCCCACTGGCCATC
TATAACTCTATCAGCTACAAGACATTCTTACCAAAATGTATTCGAGCAAAGATCCAAGAC
TATCATATTTTGACAAGGAAGCGAATAAGGTACAGATTTCGCAGATTTATTCAGCAATTC
AGCCAATGCAAAGCCACTGCCAGAAACTTGAAACTTAAGTATCTTATAAATCTGGAAACT
CTGCAGTCTGCCTTCTACACAGAGAAATTTGAAGTAAAAGAACCTGGAAGTGGTCCTTCA
GGTGAGGAGATTTTTGCAACCATTATAATAACTGGAAACGGTGGAATTCAGTGGTCAAGA
GGGAAACATAAAGAAAGTGAGACACTGACAGAACAGGATTTACAGTTATATTGCGATTTT
CCTAATATTATTGATGTCAGTATTAAGCAAGCAAACCAAGAGGGTTCAAATGAAAGCCGA
GTTGTAACTATCCATAAGCAAGATGGTAAAAATCTGGAAATTGAACTTAGCTCATTAAGG
GAAGCTTTGTCTTTCGTGTCATTAATTGATGGATATTATAGATTAACTGCAGATGCACAT
CATTACCTCTGTAAAGAAGTAGCACCTCCAGCCGTGCTTGAAAATATACAAAGCAACTGT
CATGGCCCAATTTCGATGGATTTTGCCATTAGTAAACTGAAGAAAGCAGGTAATCAGACT
GGACTGTATGTACTTCGATGCAGTCCTAAGGACTTTAATAAATATTTTTTGACTTTTGCT
GTCGAGCGAGAAAATGTCATTGAATATAAACACTGTTTGATTACAAAAAATGAGAATGAA
GAGTACAACCTCAGTGGGACAAAGAAGAACTTCAGCAGTCTTAAAGATCTTTTGAATTGT
TACCAGATGGAAACTGTTCGCTCAGACAATATAATTTTCCAGTTTACTAAATGCTGTCCC
CCAAAGCCAAAAGATAAATCAAACCTTCTAGTCTTCAGAACGAATGGTGTTTCTGATGTA
CCAACCTCACCAACATTACAGAGGCCTACTCATATGAACCAAATGGTGTTTCACAAAATC
AGAAATGAAGATTTGATATTTAATGAAAGCCTTGGCCAAGGCACTTTTACAAAGATTTTT
AAAGGCGTACGAAGAGAAGTAGGAGACTACGGTCAACTGCATGAAACAGAAGTTCTTTTA
AAAGTTCTGGATAAAGCACACAGAAACTATTCAGAGTCTTTCTTTGAAGCAGCAAGTATG
ATGAGCAAGCTTTCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTGTCTGTGGAGAC
GAGAATATTCTGGTTCAGGAGTTTGTAAAATTTGGATCACTAGATACATATCTGAAAAAG
AATAAAAATTGTATAAATATATTATGGAAACTTGAAGTTGCTAAACAGTTGGCATGGGCC
ATGCATTTTCTAGAAGAAAACACCCTTATTCATGGGAATGTATGTGCCAAAAATATTCTG
CTTATCAGAGAAGAAGACAGGAAGACAGGAAATCCTCCTTTCATCAAACTTAGTGATCCT
GGCATTAGTATTACAGTTTTGCCAAAGGACATTCTTCAGGAGAGAATACCATGGGTACCA
CCTGAATGCATTGAAAATCCTAAAAATTTAAATTTGGCAACAGACAAATGGAGTTTTGGT
ACCACTTTGTGGGAAATCTGCAGTGGAGGAGATAAACCTCTAAGTGCTCTGGATTCTCAA
AGAAAGCTACAATTTTATGAAGATAGGCATCAGCTTCCTGCACCAAAGTGGGCAGAATTA
GCAAACCTTATAAATAATTGTATGGATTATGAACCAGATTTCAGGCCTTCTTTCAGAGCC
ATCATACGAGATCTTAACAGTTTGTTTACTCCAGATTATGAACTATTAACAGAAAATGAC
ATGTTACCAAATATGAGGATAGGTGCCCTGGGGTTTTCTGGTGCCTTTGAAGACCGGGAT
CCTACACAGTTTGAAGAGAGACATTTGAAATTTCTACAGCAACTTGGCAAGGGTAATTTT
GGGAGTGTGGAGATGTGCCGGTATGACCCTCTACAGGACAACACTGGGGAGGTGGTCGCT
GTAAAAAAGCTTCAGCATAGTACTGAAGAGCACCTAAGAGACTTTGAAAGGGAAATTGAA
ATCCTGAAATCCCTACAGCATGACAACATTGTAAAGTACAAGGGAGTGTGCTACAGTGCT
GGTCGGCGTAATCTAAAATTAATTATGGAATATTTACCATATGGAAGTTTACGAGACTAT
CTTCAAAAACATAAAGAACGGATAGATCACATAAAACTTCTGCAGTACACATCTCAGATA
TGCAAGGGTATGGAGTATCTTGGTACAAAAAGGTATATCCACAGGGATCTGGCAACGAGA
AATATATTGGTGGAGAACGAGAACAGAGTTAAAATTGGAGATTTTGGGTTAACCAAAGTC
TTGCCACAAGACAAAGAATACTATAAAGTAAAAGAACCTGGTGAAAGTCCCATATTCTGG
TATGCTCCAGAATCACTGACAGAGAGCAAGTTTTCTGTGGCCTCAGATGTTTGGAGCTTT
GGAGTGGTTCTGTATGAACTTTTCACATACATTGAGAAGAGTAAAAGTCCACCAGCGGAA
TTTATGCGTATGATTGGCAATGACAAACAAGGACAGATGATCGTGTTCCATTTGATAGAA
CTTTTGAAGAATAATGGAAGATTACCAAGACCAGATGGATGCCCAGATGAGATCTATATG
ATCATGACAGAATGCTGGAACAATAATGTAAATCAACGCCCCTCCTTTAGGGATCTAGCT
CTTCGAGTGGATCAAATAAGGGATAACATGGCTGGATGA

Clone variation with respect to NM_004972.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004972 unedited
GGCGCTCATGTATACGACTCCTATAGGGCGGCGCGCGAATTCGGCACGAGGCAGCAGCGG
ACGCCGCTAACGGCCTCCCTCGGCGCTGACAGGCTGGGCCGGCGCCCGGCTCGCTTGGGT
GTTCGCGTCGCCACTTCGGCTTCTCGGCCGGTCGGGCCCCTCGGCCCGGGCTTGCGGCGC
GCGTCGGGGCTGAGGGCTGCTGCGGCGCAGGGAGAGGCCTGGTCCTCGCTGCCGAGGGAT
GTGAGTGGGAGCTGAGCCCACACTGGAGGGCCCCCGAGGGCCCAGCCTGGAGGTCGTTCA
GAGCCGTGCCCGCCCCGGGGCTTCGCAGACCTTGACCCGCCGGGTTTCAGAAGCAGGCAA
CAGGAACAAGATGTGAACTGTTTCTCTTCTGCAGAAAAAGAGGCTCTTCCTCCTCCTCCC
GCGACGGCAAATGTTCTGAAAAAGACTCTGCATGGGAATGGCCTGCCTTACGATGACAGA
AATGGAGGGAACATCCACCTCTTCTATATATCAGAATGGTGATATTTCTGGAAATGCCAA
TTCTATGAAGCAAATAGATCCAGTTCTTCAGGTGTATCTTTACCATTCCCTTGGGAAATC
TGAGGCAGATTATCTGACCTTTCCATCTGGGGAGTATGTTGCAGAAGAAATCTGTATTGC
TGCTTCTAAAGCTTGTGGTATCACACCTGTGTATCATAATATGTTTGCTTTAATGAGTGA
AACAGAAAGGATCTGGTATCCACCCAACCATGTCTTCCATATAGATGAGTCAACCAGGCA
TAATGTACTCTACAGAATAAGATTTTACTTTCCTCGTTGGTATTGCAGTGGCAGCAACAG
AGCCTATCGGCATGGATATCTCGAGGTGCTGAAGCTCCTCTTCTTGATGACTTTGTCATG
GTCTTAACCTCTTTGCTCAGTGGCGGCATGATTTTTGGTGCACCGATTGGGATAAA
Tag Tag Free
ACCN NM_004972
ORF Size 3399 bp
Insert Size 5000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004972.2, NP_004963
RefSeq Size 5097
RefSeq ORF 3399
Locus ID 3717
Cytogenetics 9p24.1
Domains B41, pkinase, SH2, TyrKc, S_TKc
Protein Families Protein Kinase, Druggable Genome
Protein Pathways Chemokine signaling pathway, Jak-STAT signaling pathway, Adipocytokine signaling pathway
Gene Summary This gene product is a protein tyrosine kinase involved in a specific subset of cytokine receptor signaling pathways. It has been found to be constituitively associated with the prolactin receptor and is required for responses to gamma interferon. Mice that do not express an active protein for this gene exhibit embryonic lethality associated with the absence of definitive erythropoiesis. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations