SPI1 (NM_001080547) Human Untagged Clone

SKU
SC315715
SPI1 (untagged)-Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 1
$450.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SPI1
Synonyms OF; PU.1; SFPI1; SPI-1; SPI-A
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC127924 sequence for NM_003120 edited (data generated by NextGen Sequencing)
ATGTTACAGGCGTGCAAAATGGAAGGGTTTCCCCTCGTCCCCCCTCCATCAGAAGACCTG
GTGCCCTATGACACGGATCTATACCAACGCCAAACGCACGAGTATTACCCCTATCTCAGC
AGTGATGGGGAGAGCCATAGCGACCATTACTGGGACTTCCACCCCCACCACGTGCACAGC
GAGTTCGAGAGCTTCGCCGAGAACAACTTCACGGAGCTCCAGAGCGTGCAGCCCCCGCAG
CTGCAGCAGCTCTACCGCCACATGGAGCTGGAGCAGATGCACGTCCTCGATACCCCCATG
GTGCCACCCCATCCCAGTCTTGGCCACCAGGTCTCCTACCTGCCCCGGATGTGCCTCCAG
TACCCATCCCTGTCCCCAGCCCAGCCCAGCTCAGATGAGGAGGAGGGCGAGCGGCAGAGC
CCCCCACTGGAGGTGTCTGACGGCGAGGCGGATGGCCTGGAGCCCGGGCCTGGGCTCCTG
CCTGGGGAGACAGGCAGCAAGAAGAAGATCCGCCTGTACCAGTTCCTGTTGGACCTGCTC
CGCAGCGGCGACATGAAGGACAGCATCTGGTGGGTGGACAAGGACAAGGGCACCTTCCAG
TTCTCGTCCAAGCACAAGGAGGCGCTGGCGCACCGCTGGGGCATCCAGAAGGGCAACCGC
AAGAAGATGACCTACCAGAAGATGGCGCGCGCGCTGCGCAACTACGGCAAGACGGGCGAG
GTCAAGAAGGTGAAGAAGAAGCTCACCTACCAGTTCAGCGGCGAAGTGCTGGGCCGCGGG
GGCCTGGCCGAGCGGCGCCACCCGCCCCACTGA

Clone variation with respect to NM_003120.2
Restriction Sites NotI-NotI
ACCN NM_001080547
Insert Size 1500 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001080547.1, NP_001074016.1
RefSeq Size 1426 bp
RefSeq ORF 816 bp
Locus ID 6688
UniProt ID P17947
Cytogenetics 11p11.2
Protein Families Transcription Factors
Protein Pathways Acute myeloid leukemia, Pathways in cancer
Summary This gene encodes an ETS-domain transcription factor that activates gene expression during myeloid and B-lymphoid cell development. The nuclear protein binds to a purine-rich sequence known as the PU-box found near the promoters of target genes, and regulates their expression in coordination with other transcription factors and cofactors. The protein can also regulate alternative splicing of target genes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Write Your Own Review
You're reviewing:SPI1 (NM_001080547) Human Untagged Clone
Your Rating
SKU Description Size Price
RC217488 SPI1 (Myc-DDK-tagged)-Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 1 10 ug
$300.00
RC217488L1 Lenti ORF clone of Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC217488L2 Lenti ORF clone of Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 1, mGFP tagged 10 ug
$600.00
RC217488L3 Lenti ORF clone of Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC217488L4 Lenti ORF clone of Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 1, mGFP tagged 10 ug
$600.00
RG217488 SPI1 (tGFP-tagged) - Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.