XBP1 (NM_001079539) Human Untagged Clone

CAT#: SC315541

XBP1 (untagged)-Human X-box binding protein 1 (XBP1), transcript variant 2

USD 608


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name XBP1 (NM_001079539) Human Untagged Clone
Symbol XBP1
Synonyms TREB-5; TREB5; XBP-1; XBP2
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001079539 edited
GCGGCGCGCGGTGCGCGGTGCGTAGTCTGGAGCTATGGTGGTGGTGGCAGCCGCGCCGAA
CCCGGCCGACGGGACCCCTAAAGTTCTGCTTCTGTCGGGGCAGCCCGCCTCCGCCGCCGG
AGCCCCGGCCGGCCAGGCCCTGCCGCTCATGGTGCCAGCCCAGAGAGGGGCCAGCCCGGA
GGCAGCGAGCGGGGGGCTGCCCCAGGCGCGCAAGCGACAGCGCCTCACGCACCTGAGCCC
CGAGGAGAAGGCGCTGAGGAGGAAACTGAAAAACAGAGTAGCAGCTCAGACTGCCAGAGA
TCGAAAGAAGGCTCGAATGAGTGAGCTGGAACAGCAAGTGGTAGATTTAGAAGAAGAGAA
CCAAAAACTTTTGCTAGAAAATCAGCTTTTACGAGAGAAAACTCATGGCCTTGTAGTTGA
GAACCAGGAGTTAAGACAGCGCTTGGGGATGGATGCCCTGGTTGCTGAAGAGGAGGCGGA
AGCCAAGGGGAATGAAGTGAGGCCAGTGGCCGGGTCTGCTGAGTCCGCAGCAGGTGCAGG
CCCAGTTGTCACCCCTCCAGAACATCTCCCCATGGATTCTGGCGGTATTGACTCTTCAGA
TTCAGAGTCTGATATCCTGTTGGGCATTCTGGACAACTTGGACCCAGTCATGTTCTTCAA
ATGCCCTTCCCCAGAGCCTGCCAGCCTGGAGGAGCTCCCAGAGGTCTACCCAGAAGGACC
CAGTTCCTTACCAGCCTCCCTTTCTCTGTCAGTGGGGACGTCATCAGCCAAGCTGGAAGC
CATTAATGAACTAATTCGTTTTGACCACATATATACCAAGCCCCTAGTCTTAGAGATACC
CTCTGAGACAGAGAGCCAAGCTAATGTGGTAGTGAAAATCGAGGAAGCACCTCTCAGCCC
CTCAGAGAATGATCACCCTGAATTCATTGTCTCAGTGAAGGAAGAACCTGTAGAAGATGA
CCTCGTTCCGGAGCTGGGTATCTCAAATCTGCTTTCATCCAGCCACTGCCCAAAGCCATC
TTCCTGCCTACTGGATGCTTACAGTGACTGTGGATACGGGGGTTCCCTTTCCCCATTCAG
TGACATGTCCTCTCTGCTTGGTGTAAACCATTCTTGGGAGGACACTTTTGCCAATGAACT
CTTTCCCCAGCTGATTAGTGTCTAAGGAATGATCCAATACTGTTGCCCTTTTCCTTGACT
ATTACACTGCCTGGAGGATAGCAGAGAAGCCTGTCTGTACTTCATTCAAAAAGCCAAAAT
AGAGAGTATACAGTCCTAGAGAATTCCTCTATTTGTTCAGATCTCATAGATGACCCCCAG
GTATTGTCTTTTGACATCCAGCAGTCCAAGGTATTGAGACATATTACTGGAAGTAAGAAA
TATTACTATAATTGAGAACTACAGCTTTTAAGATTGTACTTTTATCTTAAAAGGGTGGTA
GTTTTCCCTAAAATACTTATTATGTAAGGGTCATTAGACAAATGTCTTGAAGTAGACATG
GAATTTATGAATGGTTCTTTATCATTTCTCTTCCCCCTTTTTGGCATCCTGGCTTGCCTC
CAGTTTTAGGTCCTTTAGTTTGCTTCTGTAAGCAACGGGAACACCTGCTGAGGGGGCTCT
TTCCCTCATGTATACTTCAAGTAAGATCAAGAATCTTTTGTGAAATTATAGAAATTTACT
ATGTAAATGCTTGATGGAATTTTTTCCTGCTAGTGTAGCTTCTGAAAGGTGCTTTCTCCA
TTTATTTAAAACTACCCATGCAATTAAAAGGTACAATGCAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001079539 unedited
GTTCAGGTCACAATTTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGGCGG
CGCGCGGTGCGCGGTGCGTAGTCTGGAGCTATGGTGGTGGTGGCAGCCGCGCCGAACCCG
GCCGACGGGACCCCTAAAGTTCTGCTTCTGTCGGGGCAGCCCGCCTCCGCCGCCGGAGCC
CCGGCCGGCCAGGCCCTGCCGCTCATGGTGCCAGCCCAGAGAGGGGCCAGCCCGGAGGCA
GCGAGCGGGGGGCTGCCCCAGGCGCGCAAGCGACAGCGCCTCACGCACCTGAGCCCCGAG
GAGAAGGCGCTGAGGAGGAAACTGAAAAACAGAGTAGCAGCTCAGACTGCCAGAGATCGA
AAGAAGGCTCGAATGAGTGAGCTGGAACAGCAAGTGGTAGATTTAGAAGAAGAGAACCAA
AAACTTTTGCTAGAAAATCAGCTTTTACGAGAGAAAACTCATGGCCTTGTAGTTGAGAAC
CAGGAGTTAAGACAGCGCTTGGGGATGGATGCCCTGGTTGCTGAAGAGGAGGCGGAAGCC
AAGGGGAATGAAGTGAGGCCAGTGGCCGGGTCTGCTGAGTCCGCAGCAGGTGCAGGCCCA
GTTGTCACCCCTCCAGAACATCTCCCCATGGATTCTGGGCGTATTGACTCTTCAGATTCA
GAGTCTGATATCCTGTTGGGCATTCTGGACAACTGNACCCAGTCATGTTCTTCAAATGCC
CTTCCCCAAAGCCTGCCAGCCTGGNAGAGCTCCCAGAGGTCTACCCAGAAGGACCCAGTT
CCTTACCAGCCTCCCTTTCTCTGTCAGTGGGGACGTCATCAGCCAAGCTGGGAGCCCATT
ATGAAACTAATCGTTTTGACCACTATATACCAAGCCCCCTATCTTAGAGATACCCTCTGA
ACAGAGGCCAAGCTATGTGGTC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001079539 unedited
CCATCGGNGATGGCAACTTCCAGGNCCAGGNAAAGCACTGGGGNAGGGTCACAGGGATGC
CACCCGGGATCTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTT
TTTTTTTTTTTTTGCATTGTACCTTTTAATTGCATGGGTAGTTTTAAATAAATGGAGAAA
GCACCTTTCAGAAGCTACACTAGCAGGAAAAAATTCCATCAAGCATTTACATAGTAAATT
TCTATAATTTCACAAAAGATTCTTGATCTTACTTGAAGTATACATGAGGGAAAGAGCCCC
CTCAGCAGGTGTTCCCGTTGCTTACAGAAGCAAACTAAAGGACCTAAAACTGGAGGCAAG
CCAGGATGCCAAAAAGGGGGAAGAGAAATGATAAAGAACCATTCATAAATTCCATGTCTA
CTTCAAGACATTTGTCTAATGACCCTTACATAATAAGTATTTTAGGGAAAACTACCACCC
TTTTAAGATAAAAGTACAATCTTAAAAGCTGTAGTTCTCAATTATAGTAATATTTCTTAC
TTCCAGTAATATGTCTCAATACCTTGGACTGCTGGATGTCAAAAGACAATACCTGGGGGT
CATCTATGAGATCTGAACAAATAGAGGAATTCTCTAGGACTGTATACTCTCTATTTTGGC
TTTTTGAATGAAGTACAGACAGGCTTCTCTGCTATCCTCCAGGCAGTGTAATAGTCAAGG
AAAAGGGCAACAGTATTGGATCATTCCTTAGACACTAATCAGCTGGGGAAAGAGTTCATT
GGCAAAAGTGTCCTCCCAAAATGGTTTACACCAAGCAGAGAGGACATGTCACTGAATGGG
GGAAAGGGAAACCCCGTATCCACAGTCACTGTAAGCATCCAGTAGGCAGGAAGATGGCTT
TTGGGCANTGGCTGGATGAAAGCANATTTGAGATACCAGCT
Tag Tag Free
ACCN NM_001079539
ORF Size 1131 bp
Insert Size 1800
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001079539.1, NP_001073007
RefSeq Size 1810
RefSeq ORF 1131
Locus ID 7494
Cytogenetics 22q12.1|22q12
Protein Families Transcription Factors
Gene Summary This gene encodes a transcription factor that regulates MHC class II genes by binding to a promoter element referred to as an X box. This gene product is a bZIP protein, which was also identified as a cellular transcription factor that binds to an enhancer in the promoter of the T cell leukemia virus type 1 promoter. It may increase expression of viral proteins by acting as the DNA binding partner of a viral transactivator. It has been found that upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), the mRNA of this gene is processed to an active form by an unconventional splicing mechanism that is mediated by the endonuclease inositol-requiring enzyme 1 (IRE1). The resulting loss of 26 nt from the spliced mRNA causes a frame-shift and an isoform XBP1(S), which is the functionally active transcription factor. The isoform encoded by the unspliced mRNA, XBP1(U), is constitutively expressed, and thought to function as a negative feedback regulator of XBP1(S), which shuts off transcription of target genes during the recovery phase of ER stress. A pseudogene of XBP1 has been identified and localized to chromosome 5. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (2) lacks a 26 nt segment in the CDS compared to variant 1, that causes a frameshift. The resulting isoform, XBP1(S), has the same N-terminus, but a longer and distinct C-terminus compared to isoform XBP1(U). Isoform XBP1(S) functions as a transcription factor.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations