Orexin Receptor 1(HCRTR1) (NM_001525) Human Untagged Clone

CAT#: SC315431

HCRTR1 (untagged)-Human hypocretin (orexin) receptor 1 (HCRTR1)

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Orexin Receptor 1(HCRTR1) (NM_001525) Human Untagged Clone
Symbol HCRTR1
Synonyms OX1R
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001525 edited
GGGGAGGGGCGGGGAGCTGGGCTGGCTGGATTTATGAATGGAGAGCGACCCGCGCGCCGG
AACAGCGGCTCCTGGCGGCCGTCGGGGAGCGTCGCGGCCCTGGGGACCCAAAGGGGCCTC
TTAGGGGGCCTGGATGCTCCCCTTGCTCGCAAGGGGTCGTCAGTCCCTCCGCGCACCACC
CCCACTGTGTGTGTGTTGTATGTGTGCGTGTCCGCGAGTGCCCACCGGAGGGTCTGGCAG
GTATGGCGGGTGGGGCTTGGGTCTCTAACACCTCCCTTGGCCCGTTTTCCCAACCCAAAG
TTAAAGCCTCTGAACTGGCTCAAGAAATATTTGCAATCGGGATGGCTTCTCCTCCCAAAT
CTACGGTGTTTGGTGGGTTCGAACAGACCTGGCTTAAGAGCTTTGTGACCTTGAGCAAGA
GACTCAATCTCTCTGAGCTTCGGTCTCATCTGCAAAGCAGGGTACCCTAATAATGGTAAC
CGGAAACGTCCCCGAAACTACCTTCTCGTACCAGGTTCTTGGTGAAGCACTTGGCACGCA
TCGGAGCTCATTACTCCTCATCGTGGTCCTGTAAGGTATGTAGGGCTGTCACCCCATTAG
ACAGATGGGGAAACCAAGGCTGAAAGAGGCCAGGTAAGCTACCCAAGGCAACTGGTGTGG
AATTGGGATGCAACCCAGGTCTGTCTTCCTCCACCAATTTCATGACTGTGAGAATTAAGA
GGGAACTTATACGCAAAGCGCCTGGCACAATCCCTAATGTTTCCTTCCTTCTCTCTTTTC
CCACTCCTCCTTTCCTTCCTCCCTTCAGGAAGTTTGAGGCTGAGACCCGAAAAGACCTGG
GTGCAAGCCTCCAGGCACCCTGAAGGGAGTGGGCTGAGGGCTGGCCCAAGCTCCCTCCTC
TCCCTCTGTAGAGCCTAGGATGCCCCTCTGCTGCAGCGGCTCCTGAGCTCATGGAGCCCT
CAGCCACCCCAGGGGCCCAGATGGGGGTCCCCCCTGGCAGCAGAGAGCCGTCCCCTGTGC
CTCCAGACTATGAAGATGAGTTTCTCCGCTATCTGTGGCGTGATTATCTGTACCCAAAAC
AGTATGAGTGGGTCCTCATCGCAGCCTATGTGGCTGTGTTCGTCGTGGCCCTGGTGGGCA
ACACGCTGGTCTGCCTGGCCGTGTGGCGGAACCACCACATGAGGACAGTCACCAACTACT
TCATTGTCAACCTGTCCCTGGCTGACGTTCTGGTGACTGCTATCTGCCTGCCGGCCAGCC
TGCTGGTGGACATCACTGAGTCCTGGCTGTTCGGCCATGCCCTCTGCAAGGTCATCCCCT
ATCTACAGGCTGTGTCCGTGTCAGTGGCAGTGCTAACTCTCAGCTTCATCGCCCTGGACC
GCTGGTATGCCATCTGCCACCCACTATTGTTCAAGAGCACAGCCCGGCGGGCCCGTGGCT
CCATCCTGGGCATCTGGGCTGTGTCGCTGGCCATCATGGTGCCCCAGGCTGCAGTCATGG
AATGCAGCAGTGTGCTGCCTGAGCTAGCCAACCGCACACGGCTCTTCTCAGTCTGTGATG
AACGCTGGGCAGATGACCTCTATCCCAAGATCTACCACAGTTGCTTCTTTATTGTCACCT
ACCTGGCCCCACTGGGCCTCATGGCCATGGCCTATTTCCAGATATTCCGCAAGCTCTGGG
GCCGCCAGATCCCCGGCACCACCTCAGCACTGGTGCGGAACTGGAAGCGCCCCTCAGACC
AGCTGGGGGACCTGGAGCAGGGCCTGAGTGGAGAGCCCCAGCCCCGGGCCCGCGCCTTCC
TGGCTGAAGTGAAGCAGATGCGTGCACGGAGGAAGACAGCCAAGATGCTGATGGTGGTGC
TGCTGGTCTTCGCCCTCTGCTACCTGCCCATCAGCGTCCTCAATGTCCTTAAGAGGGTGT
TCGGGATGTTCCGCCAAGCCAGTGACCGCGAAGCTGTCTACGCCTGCTTCACCTTCTCCC
ACTGGCTGGTGTACGCCAACAGCGCTGCCAACCCCATCATCTACAACTTCCTCAGTGGCA
AATTCCGGGAGCAGTTTAAGGCTGCCTTCTCCTGCTGCCTGCCTGGCCTGGGTCCCTGCG
GCTCTCTGAAGGCCCCTAGTCCCCGCTCCTCTGCCAGCCACAAGTCCTTGTCCTTGCAGA
GCCGATGCTCCGTCTCCAAAATCTCTGAGCATGTGGTGCTCACCAGCGTCACCACAGTGC
TGCCCTGAGCGAGGGCTGCCCTGGAGGCTCCGGCTCGGGGGATCTGCCCCTACCCCTCAT
GGAAAGACAGCTGGATGTGGTGAAAGGCTGTGGCTTCAGTCCTGGGTTTCTGCCTGTGTG
ACTCTGGATAAGTCACTTCCTCTGTCTGAGCTTGTGTCCCCGAAGCAGGGTTGATGTGAG
GATTAAGCATGCTGAAGCAAGTGGAAAGCTCCTTGTAAACTGTGAAGTGTTGTGGACATG
AAAAAAAAAAAAAAAAAA
Tag Tag Free
ACCN NM_001525
ORF Size 1278 bp
Insert Size 2500
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone is found to be a good match to NM_001525.1 except for 2 SNPs.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001525.1, NP_001516
RefSeq Size 1564
Locus ID 3061
Cytogenetics 1p35.2
Protein Families GPCR, ES Cell Differentiation/IPS, Transmembrane, Druggable Genome
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein selectively binds the hypothalamic neuropeptide orexin A. A related gene (HCRTR2) encodes a G-protein coupled receptor that binds orexin A and orexin B. [provided by RefSeq, Jan 2009]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.