DNAAF4 (NM_130810) Human Untagged Clone

SKU
SC313387
DYX1C1 (untagged)-Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 1
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DNAAF4
Synonyms CILD25; DYX1; DYX1C1; DYXC1; EKN1; RD
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_130810 edited
CCAGCCGCGCTATCCGCTCCCGTTGCTACCGGAATGCCTCTTCAGGTTAGCGATTACAGC
TGGCAGCAGACGAAGACTGCGGTCTTTCTGTCTCTGCCCCTCAAAGGCGTGTGCGTCAGA
GACACGGACGTGTTCTGCACGGAAAACTATCTGAAGGTCAACTTTCCTCCATTTTTATTT
GAGGCATTTCTTTATGCTCCCATAGACGATGAGAGCAGCAAAGCAAAGATTGGGAATGAC
ACCATTGTCTTCACCTTGTATAAAAAAGAAGCGGCCATGTGGGAGACCCTTTCTGTGACG
GGTGTGACAAAGAGATGATGCAAAGAATTAGAGAAAAATCTATTTTACAAGCACAAGAGA
GAGCAAAAGAAGCTACAGAAGCAAAAGCTGCAGCAAAGCGGGAAGATCAAAAATACGCAC
TAAGTGTCATGATGAAGATTGAAGAAGAAGAGAGGAAAAAAATAGAAGATATGAAAGAAA
ATGAACGGATAAAAGCCACTAAAGCATTGGAAGCCTGGAAAGAATATCAAAGAAAAGCTG
AGGAGCAAAAAAAAATTCAGAGAGAAGAGAAATTATGTCAAAAAGAAAAGCAAATTAAAG
AAGGAAGAAAAAAAATAAAATATAAGAGTCTTACTAGAAATTTGGCATCTAGAAATCTTG
CTCCAAAAGGGAGAAATTCAGAAAATATATTTACTGAGAAGTTAAAGGAAGACAGTATTC
CTGCTCCTCGCTCTGTTGGCAGTATTAAAATCAACTTTACCCCTCGAGTATTCCCAACAG
CTCTTCGTGAATCACAAGTAGCAGAAGAGGAGGAGTGGCTACACAAACAAGCTGAGGCAC
GAAGAGCAATGAATACTGACATAGCTGAACTTTGCGATTTAAAAGAAGAAGAAAAGAACC
CAGAATGGTTGAAGGATAAAGGAAACAAATTGTTTGCAACGGAAAACTATTTGGCAGCTA
TCAATGCATATAATTTAGCCATAAGACTAAATAATAAGATGCCACTATTGTATTTGAACC
GGGCTGCTTGCCACCTAAAACTAAAAAACTTACACAAGGCTATTGAAGATTCTTCTAAGG
CACTGGAATTATTGATGCCACCTGTTACAGACAATGCTAATGCAAGAATGAAGGCACATG
TACGACGTGGAACAGCATTCTGTCAACTAGAATTGTATGTAGAAGGCCTACAGGATTATG
AAGCGGCACTTAAGATTGATCCATCCAACAAAATTGTACAAATTGATGCTGAGAAGATTC
GGAATGTAATTCAAGGAACAGAACTAAAATCTTAA
Restriction Sites Please inquire
ACCN NM_130810
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_130810.1, NP_570722.1
RefSeq Size 1993 bp
RefSeq ORF 1263 bp
Locus ID 161582
UniProt ID Q8WXU2
Cytogenetics 15q21.3
Domains TPR
Summary This gene encodes a tetratricopeptide repeat domain-containing protein. The encoded protein interacts with estrogen receptors and the heat shock proteins, Hsp70 and Hsp90. An homologous protein in rat has been shown to function in neuronal migration in the developing neocortex. A chromosomal translocation involving this gene is associated with a susceptibility to developmental dyslexia. Mutations in this gene are associated with deficits in reading and spelling. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream cell cycle progression 1 (CCPG1) gene. [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).
Write Your Own Review
You're reviewing:DNAAF4 (NM_130810) Human Untagged Clone
Your Rating
SKU Description Size Price
RC214186 DYX1C1 (Myc-DDK-tagged)-Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 1 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RC214186L3 Lenti-ORF clone of DYX1C1 (Myc-DDK-tagged)-Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 1 10 ug
$757.00
RC214186L4 Lenti-ORF clone of DYX1C1 (mGFP-tagged)-Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 1 10 ug
$757.00
RG214186 DYX1C1 (tGFP-tagged) - Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 1 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.