G CSF (CSF3) (NM_000759) Human Untagged Clone

SKU SC312456

CSF3 (untagged)-Human colony stimulating factor 3 (granulocyte) (CSF3), transcript variant 1

Product Data

• Type: Human Untagged Clone
• Target Symbol: G CSF
• Synonyms: C17orf33; CSF3OS; GCSF
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_000759 edited; GCCCTTAATGGGGATTAAAGGCACCCAGTGTCCCCGAGAGGGCCTCAGGTGGTAGGGAAC; AGCATGTCTCCTGAGCCCGCTTTGTCCCCAATGGCTGGACCTGCCACCCAGAGCCCCATG; AAGCTGATGGCCCTGCAGCTGCTGCTGTGGCATAGTGCACTCTGGACAGTGCAGGAAGCC; ACCCCCCTGGGCCCTGCCAGCTCCCTGCCCCAGAGCTTCCTGCTCAAGTGCTTAGAGCAA; GTGAGGAAGATCCAGGGCGATGGCGCAGCGCTCCAGGAGAAGCTGGTGAGTGAGTGTGCC; ACCTACAAGCTGTGCCACCCCGAGGAGCTGGTGCTGCTCGGACACTCTCTGGGCATCCCC; TGGGCTCCCCTGAGCAGCTGCCCCAGCCAGGCCCTGCAGCTGGCAGGCTGCTTGAGCCAA; CTCCATAGCGGCCTTTTCCTCTACCAGGGGCTCCTGCAGGCCCTGGAAGGGATCTCCCCC; GAGTTGGGTCCCACCTTGGACACACTGCAGCTGGACGTCGCCGACTTTGCCACCACCATC; TGGCAGCAGATGGAAGAACTGGGAATGGCCCCTGCCCTGCAGCCCACCCAGGGTGCCATG; CCGGCCTTCGCCTCTGCTTTCCAGCGCCGGGCAGGAGGGGTCCTGGTTGCCTCCCATCTG; CAGAGCTTCCTGGAGGTGTCGTACCGCGTTCTACGCCACCTTGCCCAGCCCTGAGCCAAG; CCCTCCCCATCCCATGTATTTATCTCTATTTAATATTTATGTCTATTTAAGCCTCATATT; TAAAGACAGGGAAGAGCAGAACGGA;
• Restriction Sites: Please inquire
• ACCN: NM_000759
• Insert Size: 850 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: ORF was fully sequenced and matches with NM_000759.2. One SNP was observed in the ORF.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_000759.2, NP_000750.1
• RefSeq Size: 1518 bp
• RefSeq ORF: 624 bp
• Locus ID: 1440
• UniProt ID: P09919
• Cytogenetics: 17q21.1
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein
• Protein Pathways: Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway
• Summary: This gene encodes a member of the IL-6 superfamily of cytokines. The encoded cytokine controls the production, differentiation, and function of granulocytes. Granulocytes are a type of white blood cell that are part of the innate immune response. A modified form of this protein is commonly administered to manage chemotherapy-induced neutropenia. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2020]; Transcript Variant: This variant (1) encodes the longest isoform (a).