ADAR1(ADAR) (NM_015840) Human Untagged Clone

CAT#: SC311326

ADAR (untagged)-Human adenosine deaminase, RNA-specific (ADAR), transcript variant 2

USD 2,287.00


Availability*
Please Inquire

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ADAR1(ADAR) (NM_015840) Human Untagged Clone
Symbol ADAR
Synonyms ADAR1; AGS6; DRADA; DSH; DSRAD; G1P1; IFI-4; IFI4; K88DSRBP; P136
Vector pCMV6-XL
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_015840, the custom clone sequence may differ by one or more nucleotides
ATGAATCCGCGGCAGGGGTATTCCCTCAGCGGATACTACACCCATCCATTTCAAGGCTAT
GAGCACAGACAGCTCAGGTACCAGCAGCCTGGGCCAGGATCTTCCCCCAGTAGTTTCCTG
CTTAAGCAAATAGAATTTCTCAAGGGGCAGCTCCCAGAAGCACCGGTGATTGGAAAGCAG
ACACCGTCACTGCCACCTTCCCTCCCAGGACTCCGGCCAAGGTTTCCAGTACTACTTGCC
TCCAGTACCAGAGGCAGGCAAGTGGACATCAGGGGTGTCCCCAGGGGCGTGCATCTCGGA
AGTCAGGGGCTCCAGAGAGGGTTCCAGCATCCTTCACCACGTGGCAGGAGTCTGCCACAG
AGAGGTGTTGATTGCCTTTCCTCACATTTCCAGGAACTGAGTATCTACCAAGATCAGGAA
CAAAGGATCTTAAAGTTCCTGGAAGAGCTTGGGGAAGGGAAGGCCACCACAGCACATGAT
CTGTCTGGGAAACTTGGGACTCCGAAGAAAGAAATCAATCGAGTTTTATACTCCCTGGCA
AAGAAGGGCAAGCTACAGAAAGAGGCAGGAACACCCCCTTTGTGGAAAATCGCGGTCTCC
ACTCAGGCTTGGAACCAGCACAGCGGAGTGGTAAGACCAGACGGTCATAGCCAAGGAGCC
CCAAACTCAGACCCGAGTTTGGAACCGGAAGACAGAAACTCCACATCTGTCTCAGAAGAT
CTTCTTGAGCCTTTTATTGCAGTCTCAGCTCAGGCTTGGAACCAGCACAGCGGAGTGGTA
AGACCAGACAGTCATAGCCAAGGATCCCCAAACTCAGACCCAGGTTTGGAACCTGAAGAC
AGCAACTCCACATCTGCCTTGGAAGATCCTCTTGAGTTTTTAGACATGGCCGAGATCAAG
GAGAAAATCTGCGACTATCTCTTCAATGTGTCTGACTCCTCTGCCCTGAATTTGGCTAAA
AATATTGGCCTTACCAAGGCCCGAGATATAAATGCTGTGCTAATTGACATGGAAAGGCAG
GGGGATGTCTATAGACAAGGGACAACCCCTCCCATATGGCATTTGACAGACAAGAAGCGA
GAGAGGATGCAAATCAAGAGAAATACGAACAGTGTTCCTGAAACCGCTCCAGCTGCAATC
CCTGAGACCAAAAGAAACGCAGAGTTCCTCACCTGTAATATACCCACATCAAATGCCTCA
AATAACATGGTAACCACAGAAAAAGTGGAGAATGGGCAGGAACCTGTCATAAAGTTAGAA
AACAGGCAAGAGGCCAGACCAGAACCAGCAAGACTGAAACCACCTGTTCATTACAATGGC
CCCTCAAAAGCAGGGTATGTTGACTTTGAAAATGGCCAGTGGGCCACAGATGACATCCCA
GATGACTTGAATAGTATCCGCGCAGCACCAGGTGAGTTTCGAGCCATCATGGAGATGCCC
TCCTTCTACAGTCATGGCTTGCCACGGTGTTCACCCTACAAGAAACTGACAGAGTGCCAG
CTGAAGAACCCCATCAGCGGGCTGTTAGAATATGCCCAGTTCGCTAGTCAAACCTGTGAG
TTCAACATGATAGAGCAGAGTGGACCACCCCATGAACCTCGATTTAAATTCCAGGTTGTC
ATCAATGGCCGAGAGTTTCCCCCAGCTGAAGCTGGAAGCAAGAAAGTGGCCAAGCAGGAT
GCAGCTATGAAAGCCATGACAATTCTGCTAGAGGAAGCCAAAGCCAAGGACAGTGGAAAA
TCAGAAGAATCATCCCACTATTCCACAGAGAAAGAATCAGAGAAGACTGCAGAGTCCCAG
ACCCCCACCCCTTCAGCCACATCCTTCTTTTCTGGGAAGAGCCCCGTCACCACACTGCTT
GAGTGTATGCACAAATTGGGGAACTCCTGCGAATTCCGTCTCCTGTCCAAAGAAGGCCCT
GCCCATGAACCCAAGTTCCAATACTGTGTTGCAGTGGGAGCCCAAACTTTCCCCAGTGTG
AGTGCTCCCAGCAAGAAAGTGGCAAAGCAGATGGCCGCAGAGGAAGCCATGAAGGCCCTG
CATGGGGAGGCGACCAACTCCATGGCTTCTGATAACCAGCCTGAAGGTATGATCTCAGAG
TCACTTGATAACTTGGAATCCATGATGCCCAACAAGGTCAGGAAGATTGGCGAGCTCGTG
AGATACCTGAACACCAACCCTGTGGGTGGCCTTTTGGAGTACGCCCGCTCCCATGGCTTT
GCTGCTGAATTCAAGTTGGTCGACCAGTCCGGACCTCCTCACGAGCCCAAGTTCGTTTAC
CAAGCAAAAGTTGGGGGTCGCTGGTTCCCAGCCGTCTGCGCACACAGCAAGAAGCAAGGC
AAGCAGGAAGCAGCAGATGCGGCTCTCCGTGTCTTGATTGGGGAGAACGAGAAGGCAGAA
CGCATGGGTTTCACAGAGCTCCCTCTCACTGGCAGCACCTTCCATGACCAGATAGCCATG
CTGAGCCACCGGTGCTTCAACACTCTGACTAACAGCTTCCAGCCCTCCTTGCTCGGCCGC
AAGATTCTGGCCGCCATCATTATGAAAAAAGACTCTGAGGACATGGGTGTCGTCGTCAGC
TTGGGAACAGGGAATCGCTGTGTGAAAGGAGATTCTCTCAGCCTAAAAGGAGAAACTGTC
AATGACTGCCATGCAGAAATAATCTCCCGGAGAGGCTTCATCAGGTTTCTCTACAGTGAG
TTAATGAAATACAACTCCCAGACTGCGAAGGATAGTATATTTGAACCTGCTAAGGGAGGA
GAAAAGCTCCAAATAAAAAAGACTGTGTCATTCCATCTGTATATCAGCACTGCTCCGTGT
GGAGATGGCGCCCTCTTTGACAAGTCCTGCAGCGACCGTGCTATGGAAAGCACAGAATCC
CGCCACTACCCTGTCTTCGAGAATCCCAAACAAGGAAAGCTCCGCACCAAGGTGGAGAAC
GGAGAAGGCACAATCCCTGTGGAATCCAGTGACATTGTGCCTACGTGGGATGGCATTCGG
CTCGGGGAGAGACTCCGTACCATGTCCTGTAGTGACAAAATCCTACGCTGGAACGTGCTG
GGCCTGCAAGGGGCACTGTTGACCCACTTCCTGCAGCCCATTTATCTCAAATCTGTCACA
TTGGGTTACCTTTTCAGCCAAGGGCATCTGACCCGTGCTATTTGCTGTCGTGTGACAAGA
GATGGGAGTGCATTTGAGGATGGACTACGACATCCCTTTATTGTCAACCACCCCAAGGTT
GGCAGAGTCAGCATATATGATTCCAAAAGGCAATCCGGGAAGACTAAGGAGACAAGCGTC
AACTGGTGTCTGGCTGATGGCTATGACCTGGAGATCCTGGACGGTACCAGAGGCACTGTG
GATGGGCCACGGAATGAATTGTCCCGGGTCTCCAAAAAGAACATTTTTCTTCTATTTAAG
AAGCTCTGCTCCTTCCGTTACCGCAGGGATCTACTGAGACTCTCCTATGGTGAGGCCAAG
AAAGCTGCCCGTGACTACGAGACGGCCAAGAACTACTTCAAAAAAGGCCTGAAGGATATG
GGCTATGGGAACTGGATTAGCAAACCCCAGGAGGAAAAGAACTTTTATCTCTGCCCAGTA
TAG
Tag Tag Free
ACCN NM_015840
ORF Size 3603 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_015840.2, NP_056655
RefSeq Size 6562
RefSeq ORF 3603
Locus ID 103
Cytogenetics 1q21.3
Domains z-alpha, dsrm, A_deamin
Protein Families Druggable Genome
Protein Pathways Cytosolic DNA-sensing pathway
Gene Summary This gene encodes the enzyme responsible for RNA editing by site-specific deamination of adenosines. This enzyme destabilizes double-stranded RNA through conversion of adenosine to inosine. Mutations in this gene have been associated with dyschromatosis symmetrica hereditaria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010].
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in an isoform (b, also referred to as ADAR-b) that is shorter than isoform a. There are no publicly available full-length transcripts representing this variant; it is represented based on data in PMID:9020165 and annotation on DNA accession U75503.1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)