ADAR1 (ADAR) (NM_015840) Human Untagged Clone

CAT#: SC311326

Reviews ()
Write a review

ADAR (untagged)-Human adenosine deaminase, RNA-specific (ADAR), transcript variant 2



  "NM_015840" in other vectors (2)

SC311326 is the updated version of SC114625.

USD 2,430.00


Availability*
Please Inquire

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name ADAR1 (ADAR) (NM_015840) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol ADAR
Synonyms ADAR1; AGS6; DRADA; DSH; DSRAD; G1P1; IFI-4; IFI4; K88DSRBP; P136
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_015840, the custom clone sequence may differ by one or more nucleotides
ATGAATCCGCGGCAGGGGTATTCCCTCAGCGGATACTACACCCATCCATTTCAAGGCTAT
GAGCACAGACAGCTCAGGTACCAGCAGCCTGGGCCAGGATCTTCCCCCAGTAGTTTCCTG
CTTAAGCAAATAGAATTTCTCAAGGGGCAGCTCCCAGAAGCACCGGTGATTGGAAAGCAG
ACACCGTCACTGCCACCTTCCCTCCCAGGACTCCGGCCAAGGTTTCCAGTACTACTTGCC
TCCAGTACCAGAGGCAGGCAAGTGGACATCAGGGGTGTCCCCAGGGGCGTGCATCTCGGA
AGTCAGGGGCTCCAGAGAGGGTTCCAGCATCCTTCACCACGTGGCAGGAGTCTGCCACAG
AGAGGTGTTGATTGCCTTTCCTCACATTTCCAGGAACTGAGTATCTACCAAGATCAGGAA
CAAAGGATCTTAAAGTTCCTGGAAGAGCTTGGGGAAGGGAAGGCCACCACAGCACATGAT
CTGTCTGGGAAACTTGGGACTCCGAAGAAAGAAATCAATCGAGTTTTATACTCCCTGGCA
AAGAAGGGCAAGCTACAGAAAGAGGCAGGAACACCCCCTTTGTGGAAAATCGCGGTCTCC
ACTCAGGCTTGGAACCAGCACAGCGGAGTGGTAAGACCAGACGGTCATAGCCAAGGAGCC
CCAAACTCAGACCCGAGTTTGGAACCGGAAGACAGAAACTCCACATCTGTCTCAGAAGAT
CTTCTTGAGCCTTTTATTGCAGTCTCAGCTCAGGCTTGGAACCAGCACAGCGGAGTGGTA
AGACCAGACAGTCATAGCCAAGGATCCCCAAACTCAGACCCAGGTTTGGAACCTGAAGAC
AGCAACTCCACATCTGCCTTGGAAGATCCTCTTGAGTTTTTAGACATGGCCGAGATCAAG
GAGAAAATCTGCGACTATCTCTTCAATGTGTCTGACTCCTCTGCCCTGAATTTGGCTAAA
AATATTGGCCTTACCAAGGCCCGAGATATAAATGCTGTGCTAATTGACATGGAAAGGCAG
GGGGATGTCTATAGACAAGGGACAACCCCTCCCATATGGCATTTGACAGACAAGAAGCGA
GAGAGGATGCAAATCAAGAGAAATACGAACAGTGTTCCTGAAACCGCTCCAGCTGCAATC
CCTGAGACCAAAAGAAACGCAGAGTTCCTCACCTGTAATATACCCACATCAAATGCCTCA
AATAACATGGTAACCACAGAAAAAGTGGAGAATGGGCAGGAACCTGTCATAAAGTTAGAA
AACAGGCAAGAGGCCAGACCAGAACCAGCAAGACTGAAACCACCTGTTCATTACAATGGC
CCCTCAAAAGCAGGGTATGTTGACTTTGAAAATGGCCAGTGGGCCACAGATGACATCCCA
GATGACTTGAATAGTATCCGCGCAGCACCAGGTGAGTTTCGAGCCATCATGGAGATGCCC
TCCTTCTACAGTCATGGCTTGCCACGGTGTTCACCCTACAAGAAACTGACAGAGTGCCAG
CTGAAGAACCCCATCAGCGGGCTGTTAGAATATGCCCAGTTCGCTAGTCAAACCTGTGAG
TTCAACATGATAGAGCAGAGTGGACCACCCCATGAACCTCGATTTAAATTCCAGGTTGTC
ATCAATGGCCGAGAGTTTCCCCCAGCTGAAGCTGGAAGCAAGAAAGTGGCCAAGCAGGAT
GCAGCTATGAAAGCCATGACAATTCTGCTAGAGGAAGCCAAAGCCAAGGACAGTGGAAAA
TCAGAAGAATCATCCCACTATTCCACAGAGAAAGAATCAGAGAAGACTGCAGAGTCCCAG
ACCCCCACCCCTTCAGCCACATCCTTCTTTTCTGGGAAGAGCCCCGTCACCACACTGCTT
GAGTGTATGCACAAATTGGGGAACTCCTGCGAATTCCGTCTCCTGTCCAAAGAAGGCCCT
GCCCATGAACCCAAGTTCCAATACTGTGTTGCAGTGGGAGCCCAAACTTTCCCCAGTGTG
AGTGCTCCCAGCAAGAAAGTGGCAAAGCAGATGGCCGCAGAGGAAGCCATGAAGGCCCTG
CATGGGGAGGCGACCAACTCCATGGCTTCTGATAACCAGCCTGAAGGTATGATCTCAGAG
TCACTTGATAACTTGGAATCCATGATGCCCAACAAGGTCAGGAAGATTGGCGAGCTCGTG
AGATACCTGAACACCAACCCTGTGGGTGGCCTTTTGGAGTACGCCCGCTCCCATGGCTTT
GCTGCTGAATTCAAGTTGGTCGACCAGTCCGGACCTCCTCACGAGCCCAAGTTCGTTTAC
CAAGCAAAAGTTGGGGGTCGCTGGTTCCCAGCCGTCTGCGCACACAGCAAGAAGCAAGGC
AAGCAGGAAGCAGCAGATGCGGCTCTCCGTGTCTTGATTGGGGAGAACGAGAAGGCAGAA
CGCATGGGTTTCACAGAGCTCCCTCTCACTGGCAGCACCTTCCATGACCAGATAGCCATG
CTGAGCCACCGGTGCTTCAACACTCTGACTAACAGCTTCCAGCCCTCCTTGCTCGGCCGC
AAGATTCTGGCCGCCATCATTATGAAAAAAGACTCTGAGGACATGGGTGTCGTCGTCAGC
TTGGGAACAGGGAATCGCTGTGTGAAAGGAGATTCTCTCAGCCTAAAAGGAGAAACTGTC
AATGACTGCCATGCAGAAATAATCTCCCGGAGAGGCTTCATCAGGTTTCTCTACAGTGAG
TTAATGAAATACAACTCCCAGACTGCGAAGGATAGTATATTTGAACCTGCTAAGGGAGGA
GAAAAGCTCCAAATAAAAAAGACTGTGTCATTCCATCTGTATATCAGCACTGCTCCGTGT
GGAGATGGCGCCCTCTTTGACAAGTCCTGCAGCGACCGTGCTATGGAAAGCACAGAATCC
CGCCACTACCCTGTCTTCGAGAATCCCAAACAAGGAAAGCTCCGCACCAAGGTGGAGAAC
GGAGAAGGCACAATCCCTGTGGAATCCAGTGACATTGTGCCTACGTGGGATGGCATTCGG
CTCGGGGAGAGACTCCGTACCATGTCCTGTAGTGACAAAATCCTACGCTGGAACGTGCTG
GGCCTGCAAGGGGCACTGTTGACCCACTTCCTGCAGCCCATTTATCTCAAATCTGTCACA
TTGGGTTACCTTTTCAGCCAAGGGCATCTGACCCGTGCTATTTGCTGTCGTGTGACAAGA
GATGGGAGTGCATTTGAGGATGGACTACGACATCCCTTTATTGTCAACCACCCCAAGGTT
GGCAGAGTCAGCATATATGATTCCAAAAGGCAATCCGGGAAGACTAAGGAGACAAGCGTC
AACTGGTGTCTGGCTGATGGCTATGACCTGGAGATCCTGGACGGTACCAGAGGCACTGTG
GATGGGCCACGGAATGAATTGTCCCGGGTCTCCAAAAAGAACATTTTTCTTCTATTTAAG
AAGCTCTGCTCCTTCCGTTACCGCAGGGATCTACTGAGACTCTCCTATGGTGAGGCCAAG
AAAGCTGCCCGTGACTACGAGACGGCCAAGAACTACTTCAAAAAAGGCCTGAAGGATATG
GGCTATGGGAACTGGATTAGCAAACCCCAGGAGGAAAAGAACTTTTATCTCTGCCCAGTA
TAG
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_015840
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_015840.2, NP_056655.2
RefSeq Size 6562 bp
RefSeq ORF 3603 bp
Locus ID 103
Cytogenetics 1q21.3
Domains z-alpha, DSRM, A_deamin
Protein Families Druggable Genome
Protein Pathways Cytosolic DNA-sensing pathway
Gene Summary This gene encodes the enzyme responsible for RNA editing by site-specific deamination of adenosines. This enzyme destabilizes double-stranded RNA through conversion of adenosine to inosine. Mutations in this gene have been associated with dyschromatosis symmetrica hereditaria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in an isoform (b, also referred to as ADAR-b) that is shorter than isoform a. There are no publicly available full-length transcripts representing this variant; it is represented based on data in PMID:9020165 and annotation on DNA accession U75503.1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Citations (1)

Other Versions

Other products for "ADAR"
Frequently bought together (2)
Rabbit polyclonal antibody to Adenosine Deaminase (adenosine deaminase, RNA-specific)
    • 100 ul

USD 415.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools