p90 Autoantigen(KIAA1524) (NM_020890) Human Untagged Clone

CAT#: SC311317

KIAA1524 (untagged)-Human KIAA1524 (KIAA1524)

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Cited in 1 publication.

Product images

Specifications

Product Data
Product Name p90 Autoantigen(KIAA1524) (NM_020890) Human Untagged Clone
Symbol KIAA1524
Synonyms CIP2A; p90
Vector pCMV6-XL5
Sequence Data
>OriGene sequence for NM_020890 edited
CGGTGGTGGTCCCTAAGCCGGGCCGCGGCCGGTGCAATGGACTCCACTGCCTGCTTGAAG
TCCTTGCTCCTGACTGTCAGTCAGTACAAAGCCGTGAAGTCAGAGGCGAACGCCACTCAG
CTTTTGCGGCACTTGGAGGTAATTTCTGGACAGAAACTCACACGACTATTTACATCAAAT
CAGATATTAACAAGTGAATGCTTGAGTTGCCTTGTAGAGCTACTTGAAGACCCCAACATA
AGTGCTTCACTGATCTTAAGTATTATCGGTTTGCTGTCTCAACTAGCAGTAGACATTGAA
ACCAGAGATTGTCTTCAGAATACATATAATCTGAATAGTGTGCTGGCGGGAGTGGTTTGT
CGGAGCAGCCACACTGATTCGGTGTTTTTGCAGTGCATTCAACTTCTACAGAAGTTAACA
TATAATGTCAAAATTTTCTATTCTGGTGCCAATATAGATGAATTAATTACGTTCCTGATA
GATCACATTCAATCTTCTGAAGATGAGTTAAAAATGCCTTGTCTAGGATTATTGGCAAAT
CTTTGTCGGCACAATCTTTCTGTTCAAACGCACATAAAGACATTGAGTAATGTGAAATCT
TTTTATCGAACTCTTATCACCTTGTTGGCCCATAGTAGTTTAACTGTGGTTGTGTTTGCA
CTTTCAATATTATCCAGTTTGACATTAAATGAAGAGGTGGGGGAAAAGCTATTCCATGCT
CGAAACATTCATCAGACTTTTCAACTAATATTTAATATTCTCATAAACGGTGATGGCACT
CTAACTAGAAAGTATTCAGTTGACCTACTGATGGATCTCCTTAAGAATCCTAAAATTGCT
GATTATCTCACCAGATATGAGCACTTTTCTTCATGTCTTCACCAAGTATTAGGTCTTCTT
AATGGAAAGGATCCTGATTCCTCTTCAAAGGTTTTAGAATTACTTCTTGCCTTCTGTTCA
GTGACTCAGCTGCGCCATATGCTCACTCAGATGATGTTTGAACAGTCTCCACCTGGCAGC
GCCACTCTGGGAAGCCATACTAAATGTTTAGAACCTACTGTGGCTCTACTGCGCTGGTTA
AGCCAACCTTTGGACGGATCAGAAAACTGTTCTGTTTTAGCATTGGAGTTGTTCAAGGAA
ATATTTGAGGATGTCATAGATGCTGCTAACTGTTCCTCGGCTGATCGTTTTGTGACCCTT
CTGCTGCCTACAATCCTTGATCAACTTCAGTTCACAGAACAAAATCTAGATGAGGCTTTA
ACAAGAAAAAAATGTGAAAGGATTGCCAAGGCCATTGAAGTTTTGTTAACTCTCTGTGGA
GATGATACACTAAAAATGCATATTGCAAAAATCTTGACAACTGTCAAGTGTACCACTCTT
ATAGAACAACAATTTACATATGGCAAGATTGACCTGGGATTTGGAACAAAGGTTGCAGAT
TCTGAATTATGCAAACTTGCTGCTGATGTAATTTTGAAAACTCTTGATTTGATTAACAAA
CTTAAACCATTGGTTCCTGGTATGGAAGTAAGCTTCTACAAAATACTTCAGGACCCACGT
TTGATTACTCCTTTGGCTTTTGCTTTAACGTCAGATAATAGAGAACAAGTACAGTCTGGA
CTGAGAATATTATTGGAGGCTGCTCCACTGCCAGATTTTCCTGCTTTAGTACTTGGAGAA
AGTATAGCAGCAAACAATGCCTATAGACAACAGGAAACAGAACATATACCCAGAAAAATG
CCCTGGCAATCATCAAATCACAGTTTTCCAACATCAATAAAGTGTTTAACTCCTCATTTG
AAAGATGGTGTTCCTGGATTGAATATTGAAGAATTAATAGAGAAACTTCAGTCTGGAATG
GTGGTAAAGGATCAGATTTGTGATGTGAGAATATCTGACATAATGGATGTATATGAAATG
AAACTATCCACATTAGCTTCCAAAGAAAGCAGGCTACAAGATCTTTTGGAAACAAAAGCT
CTAGCCCTTGCACAGGCTGATAGACTGATTGCTCAGCATCGCTGTCAAAGAACTCAAGCT
GAAACAGAGGCACGGACACTTGCTAGTATGTTGAGAGAAGTTGAGAGAAAAAATGAAGAG
CTTAGTGTGTTGCTGAAGGCGCAGCAAGTTGAATCAGAAAGAGCGCAGAGTGATATTGAG
CATCTCTTTCAACATAATAGGAAGTTAGAGTCTGTGGCTGAAGAACATGAAATACTGACA
AAATCCTACATGGAACTTCTTCAGAGAAATGAAAGTACTGAAAAGAAGAATAAAGATTTA
CAGATCACATGTGATTCTCTGAATAAACAAATTGAGACAGTGAAAAAGTTGAATGAGTCA
CTCAAGGAACAAAATGAAAAAAGTATTGCCCAATTAATAGAGAAAGAAGAACAGAGAAAA
GAAGTACAGAATCAGCTAGTAGACAGAGAACATAAGCTAGCAAATTTGCATCAAAAAACA
AAAGTACAAGAAGAAAAGATTAAAACCTTACAAAAGGAAAGGGAAGATAAGGAAGAAACC
ATTGATATCCTTAGAAAAGAATTAAGCAGAACAGAACAGATAAGAAAAGAGTTGAGCATT
AAGGCTTCCTCCCTAGAGGTTCAAAAGGCACAATTAGAAGGTCGTTTGGAAGAGAAAGAG
TCCTTGGTGAAACTTCAGCAAGAGGAATTGAACAAACACTCCCACATGATAGCAATGATC
CACAGTTTAAGTGGTGGAAAAATAAATCCAGAAACTGTGAATCTCAGTATATAGACATTA
TGGCATTTTGGAATTTGTAATCTCATGATATTTTTGATGTATTTATCTATTGGAGGGGGG
GTGGGTAGGGGAGTTA
Tag Tag Free
ACCN NM_020890
ORF Size 2718 bp
Insert Size 2800
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_020890.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_020890.1, NP_065941
RefSeq Size 3395
RefSeq ORF 2718
Locus ID 57650
Cytogenetics 3q13.13
Protein Families Druggable Genome
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)