FGFR1 (NM_023110) Human Untagged Clone

CAT#: SC310663

TrueClone®, FGFR1 (untagged)-Human fibroblast growth factor receptor 1 (FGFR1), transcript variant 1

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name FGFR1 (NM_023110) Human Untagged Clone
Symbol FGFR1
Synonyms bFGF-R-1; BFGFR; CD331; CEK; ECCL; FGFBR; FGFR-1; FLG; FLT-2; FLT2; HBGFR; HH2; HRTFDS; KAL2; N-SAM;
Vector pCMV6-XL4
Sequence Data
>OriGene ORF sequence for NM_023110 edited
ATGTGGAGCTGGAAGTGCCTCCTCTTCTGGGCTGTGCTGGTCACAGCCACACTCTGCACC
GCTAGGCCGTCCCCGACCTTGCCTGAACAAGCCCAGCCCTGGGGAGCCCCTGTGGAAGTG
GAGTCCTTCCTGGTCCACCCCGGTGACCTGCTGCAGCTTCGCTGTCGGCTGCGGGACGAT
GTGCAGAGCATCAACTGGCTGCGGGACGGGGTGCAGCTGGCGGAAAGCAACCGCACCCGC
ATCACAGGGGAGGAGGTGGAGGTGCAGGACTCCGTGCCCGCAGACTCCGGCCTCTATGCT
TGCGTAACCAGCAGCCCCTCGGGCAGTGACACCACCTACTTCTCCGTCAATGTTTCAGAT
GCTCTCCCCTCCTCGGAGGATGATGATGATGATGATGACTCCTCTTCAGAGGAGAAAGAA
ACAGATAACACCAAACCAAACCGTATGCCCGTAGCTCCATATTGGACATCCCCAGAAAAG
ATGGAAAAGAAATTGCATGCAGTGCCGGCTGCCAAGACAGTGAAGTTCAAATGCCCTTCC
AGTGGGACCCCAAACCCCACACTGCGCTGGTTGAAAAATGGCAAAGAATTCAAACCTGAC
CACAGAATTGGAGGCTACAAGGTCCGTTATGCCACCTGGAGCATCATAATGGACTCTGTG
GTGCCCTCTGACAAGGGCAACTACACCTGCATTGTGGAGAATGAGTACGGCAGCATCAAC
CACACATACCAGCTGGATGTCGTGGAGCGGTCCCCTCACCGGCCCATCCTGCAAGCAGGG
TTGCCCGCCAACAAAACAGTGGCCCTGGGTAGCAACGTGGAGTTCATGTGTAAGGTGTAC
AGTGACCCGCAGCCGCACATCCAGTGGCTAAAGCACATCGAGGTGAATGGGAGCAAGATT
GGCCCAGACAACCTGCCTTATGTCCAGATCTTGAAGACTGCTGGAGTTAATACCACCGAC
AAAGAGATGGAGGTGCTTCACTTAAGAAATGTCTCCTTTGAGGACGCAGGGGAGTATACG
TGCTTGGCGGGTAACTCTATCGGACTCTCCCATCACTCTGCATGGTTGACCGTTCTGGAA
GCCCTGGAAGAGAGGCCGGCAGTGATGACCTCGCCCCTGTACCTGGAGATCATCATCTAT
TGCACAGGGGCCTTCCTCATCTCCTGCATGGTGGGGTCGGTCATCGTCTACAAGATGAAG
AGTGGTACCAAGAAGAGTGACTTCCACAGCCAGATGGCTGTGCACAAGCTGGCCAAGAGC
ATCCCTCTGCGCAGACAGGTAACAGTGTCTGCTGACTCCAGTGCATCCATGAACTCTGGG
GTTCTTCTGGTTCGGCCATCACGGCTCTCCTCCAGTGGGACTCCCATGCTAGCAGGGGTC
TCTGAGTATGAGCTTCCCGAAGACCCTCGCTGGGAGCTGCCTCGGGACAGACTGGTCTTA
GGCAAACCCCTGGGAGAGGGCTGCTTTGGGCAGGTGGTGTTGGCAGAGGCTATCGGGCTG
GACAAGGACAAACCCAACCGTGTGACCAAAGTGGCTGTGAAGATGTTGAAGTCGGACGCA
ACAGAGAAAGACTTGTCAGACCTGATCTCAGAAATGGAGATGATGAAGATGATCGGGAAG
CATAAGAATATCATCAACCTGCTGGGGGCCTGCACGCAGGATGGTCCCTTGTATGTCATC
GTGGAGTATGCCTCCAAGGGCAACCTGCGGGAGTACCTGCAGGCCCGGAGGCCCCCAGGG
CTGGAATACTGCTACAACCCCAGCCACAACCCAGAGGAGCAGCTCTCCTCCAAGGACCTG
GTGTCCTGCGCCTACCAGGTGGCCCGAGGCATGGAGTATCTGGCCTCCAAGAAGTGCATA
CACCGAGACCTGGCAGCCAGGAATGTCCTGGTGACAGAGGACAATGTGATGAAGATAGCA
GACTTTGGCCTCGCACGGGACATTCACCACATCGACTACTATAAAAAGACAACCAACGGC
CGACTGCCTGTGAAGTGGATGGCACCCGAGGCATTATTTGACCGGATCTACACCCACCAG
AGTGATGTGTGGTCTTTCGGGGTGCTCCTGTGGGAGATCTTCACTCTGGGCGGCTCCCCA
TACCCCGGTGTGCCTGTGGAGGAACTTTTCAAGCTGCTGAAGGAGGGTCACCGCATGGAC
AAGCCCAGTAACTGCACCAACGAGCTGTACATGATGATGCGGGACTGCTGGCATGCAGTG
CCCTCACAGAGACCCACCTTCAAGCAGCTGGTGGAAGACCTGGACCGCATCGTGGCCTTG
ACCTCCAACCAGGAGTACCTGGACCTGTCCATGCCCCTGGACCAGTACTCCCCCAGCTTT
CCCGACACCCGGAGCTCTACGTGCTCCTCAGGGGAGGATTCCGTCTTCTCTCATGAGCCG
CTGCCCGAGGAGCCCTGCCTGCCCCGACACCCAGCCCAGCTTGCCAATGGCGGACTCAAA
CGCCGCTGACTGCCACCCACACGCCCTCCCCAGACTCCACCGTCAGCTGTAACCCTCACC
CACAGCCCCTGCTGGGCCCACCACCTGTCCGTCCCTGTCCCCTTTCCTGCTGGCAGGAGC
CGGCTGCCTACCAGGGGCCTTCCTGTGTGGCCTGCCTTCACCCCACTCAGCTCACCTCTC
CCTCCACCTCCTCTCCACCTGCTGGTGAGAGGTGCAAAGAGGCAGATCTTTGCTGCCAGC
CACTT
>OriGene 5' read for NM_023110 unedited
GTTCAAATTTTGTAATACGACTTCACTATAGGGCGGCCGCGAATTCGCACGAGGCGCAGG
GCGATGGAGCCCGGTCTGCAAGGAAAGTGAGGCGCCGCCGCTGCGTTCTGGAGGAGGGGG
GCACAAGGTCTGGAGACCCCGGGTGGCGGACGGGAGCCCTCCCCCCGCCCCGCCTCCGGG
GCACCAGCTCCGGCTCCATTGTTCCCGCCCGGGCTGGAGGCGCCGAGCACCGAGCGCCGC
CGGGAGTCGAGCGCCGGCCGCGGAGCTCTTGCGACCCCGCCAGGACCCGAACAGAGCCCG
GGGGCGGCGGGCCGGAGCCGGGGACGCGGGCACACGCCCGCTCGCACAAGCCACGGCGGA
CTCTCCCGAGGCGGAACCTCCACGCCGAGCGAGGGTCAGTTTGAAAAGGAGGATCGAGCT
CACTGTGGAGTATCCATGGAGATGTGGAGCCTTGTCACCAACCTCTAACTGCAGAACTGG
GATGTGGAGCTGGAAGTGCCTCCTCTTCTGGGCTGTGCTGGTCACAGCCACACTCTGCAC
CGCTAGGCCGTCCCCGACCTTGCCTGAACAAGCCCAGCCCTGGGGAGCCCCTGTGGAAGT
GGAGTCCTTCCTGGTCCACCCCGGTGACCTGCTGCAGCTTCNCTGTCNGCTGCGGGACGA
TGTGCANAGCATCAACTGGCTGCGGGACCGGGTGCAGCTGGCGGAAAGCAACGCACCCGC
ATCACAGGGGAGAAGTGGAGGTGCACGACTCCCTGCCCGCAAACTCCCGCCTTTATGCTG
CGTAACAGCAGCCCCTCGGCAGTGACACACCTACTTCTCCGCATGTTCAAATGCTCTCCC
TCTCCGAGATGAGAGATATGATACCCCTCCTCCGGGGAAAAAACATATACCCCACCAACC
CCGTGTTCCTT
>OriGene 3' read for NM_023110 unedited
ATGACGCGGCCGCATCTAGGATCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTCTTTTTTTATTTTTTTACCTTTTGGGTAAATTCTTGGAAACAACCCTTTTAAAAAGA
AGGGAAATATATCCCCAAATAAAACCTTTTTGGGGTGCCCCCAAACCAAAAAACAAAGCC
CCCAATTTGGGGCGGGCCCCCAGGGCCAAAACCCGGCCCCCAACCGGGCCTTACCCCCAC
CAACCTGGGGTACCAGCCAATGGGCCAAAAAAGCAAACAAGAAAGGGAAAAAAAAAACCC
CGGGCCCCACCAAACCGGGGGAAAGGGCCCCTTCAACCGAGGCACGAAACCCGGGCCCCC
CCACGGGAGAACCCCGGAGGAAAGGCACCGCCCCCCGAAAGCCAGGGGACTAAAGGGGGC
GGCAAAAACAAAAAACAGGAAGGACAAAAGCCAGAAACCCGCGCGGACAGCGAGAACTAA
GGCACCAACACAGGGGCAGGAGAAGGCAAGGTGCAACAAAAGGAAACGGCCCAAAGCGGG
ACGGGAAAAAAGAGACAAGAACAGGGACCGGACAGAGGAGGAAGAAAAAAAGGAAGCAAA
GAAAAAGGGGGCGGAGACAACAAAGAAAAGAAGGAACCAAAAAACGGGGAAGAGAAAAAA
ACAACAAGACAAACAAACAAACGAAAAACCTGAGACAGAGACGCAAGAAAAGAGAGGACG
AAGAAAAAAAGAGAGCCGCGGCGGGGAGAGCAAGAAAAGAGAAAGAAGAGAGCCGACAAA
GAAACAAAGCGGGAAAGCAAAGACGGGCCGAGGAAGAGAGAAAAAAAAAACAAAAGAGCA
GAAACGCGGACAGGAGGAAAAGAAAATCGAAGAGAGAAAAAAAAGAAAAGAC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_023110
ORF Size 2469 bp
Insert Size 2700
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_023110.2.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_023110.2, NP_075598
RefSeq Size 5917
RefSeq ORF 2469
Locus ID 2260
Cytogenetics 8p11.23
Domains ig, IGc2, IG
Protein Families Protein Kinase, Transmembrane, Druggable Genome
Protein Pathways MAPK signaling pathway, Adherens junction, Regulation of actin cytoskeleton, Pathways in cancer, Prostate cancer, Melanoma
Gene Summary The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1), also known as isoform Alpha A1, IV and the 3-Ig domain+2 AA insert form.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)