beta TRCP2 (FBXW11) (NM_012300) Human Untagged Clone
CAT#: SC310284
FBXW11 (untagged)-Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 3
"NM_012300" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | beta TRCP2 |
Synonyms | BTRC2; BTRCP2; FBW1B; Fbw11; FBXW1B; Hos; NEDJED |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_012300 edited
ATGGAGCCCGACTCGGTGATTGAGGACAAGACCATCGAGCTCATGTGTTCTGTGCCAAGG TCTTTGTGGCTAGGCTGCGCCAACCTGGTAGAGAGCATGTGCGCACTGAGTTGCCTGCAG AGCATGCCCAGTGTCAGATGTCTCCAGATAAGTAATGGAACATCATCTGTGATCGTCTCC AGAAAGAGGCCATCAGAAGGAAACTATCAAAAAGAAAAAGACTTGTGTATTAAATATTTT GACCAGTGGTCTGAATCAGATCAAGTGGAATTTGTGGAACATCTTATTTCACGAATGTGT CATTATCAGCATGGACATATTAACTCTTACCTGAAGCCCATGTTGCAGCGGGACTTTATT ACCGCTTTACCAGAGCAAGGCTTAGATCACATAGCAGAAAACATTCTTTCGTACCTGGAT GCCAGGTCTCTGTGTGCAGCAGAGCTGGTATGTAAAGAATGGCAGCGAGTGATCTCAGAA GGAATGCTTTGGAAGAAGCTGATTGAACGAATGGTACGCACTGATCCCCTATGGAAAGGA CTTTCAGAAAGAAGAGGGTGGGATCAGTACCTGTTTAAAAACAGACCCACAGATGGCCCT CCAAATTCATTTTATAGGTCATTATACCCAAAGATTATCCAGGATATAGAGACTATAGAA TCTAACTGGCGGTGTGGACGACACAACTTGCAGAGGATTCAGTGCCGCTCTGAAAATAGT AAAGGTGTCTACTGTTTACAGTACGATGATGAAAAAATTATCAGTGGCCTACGAGATAAT TCTATTAAGATATGGGATAAAACCAGCCTGGAATGTTTGAAAGTGTTAACAGGACACACA GGCTCTGTCCTCTGTCTGCAGTATGATGAGCGTGTCATTGTAACTGGCTCTTCAGATTCT ACGGTGAGAGTGTGGGATGTGAACACGGGTGAAGTTCTTAACACATTGATCCACCACAAT GAGGCTGTATTGCACTTACGCTTCAGCAATGGACTGATGGTGACCTGTTCCAAGGACCGC TCCATTGCTGTGTGGGACATGGCTTCTGCGACCGACATCACTTTACGCCGTGTCCTGGTT GGCCACCGGGCTGCCGTCAATGTAGTAGACTTTGACGACAAGTACATCGTGTCTGCCTCT GGTGACAGGACCATCAAAGTCTGGAGCACGAGCACCTGTGAATTTGTTCGTACTCTCAAT GGGCACAAGCGGGGCATTGCCTGTCTCCAGTACAGGGATCGCCTGGTTGTTAGTGGATCA TCAGATAATACCATTAGGCTCTGGGATATTGAATGTGGTGCCTGTTTAAGAGTCCTAGAG GGACATGAAGAATTGGTCCGATGCATCCGGTTTGATAACAAGAGGATTGTCAGTGGGGCC TATGATGGGAAAATTAAAGTTTGGGACTTGCAAGCTGCTCTTGACCCTCGAGCCCCAGCA AGCACATTGTGTTTGCGCACATTGGTGGAACATTCTGGACGTGTGTTTCGGCTCCAGTTT GATGAGTTTCAGATCATCAGCAGCTCCCATGATGACACTATTTTGATTTGGGATTTCTTA AATGTGCCTCCCAGTGCCCAGAATGAGACCCGTTCTCCCTCCAGAACATACACTTACATC TCTAGATAA |
Restriction Sites | NotI-NotI |
ACCN | NM_012300 |
Insert Size | 4400 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_012300.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_012300.2, NP_036432.2 |
RefSeq Size | 4575 bp |
RefSeq ORF | 1629 bp |
Locus ID | 23291 |
UniProt ID | Q9UKB1 |
Cytogenetics | 5q35.1 |
Domains | WD40, F-box |
Protein Families | Druggable Genome |
Protein Pathways | Hedgehog signaling pathway, Oocyte meiosis, Ubiquitin mediated proteolysis, Wnt signaling pathway |
Gene Summary | This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class and, in addition to an F-box, contains multiple WD40 repeats. This gene contains at least 14 exons, and its alternative splicing generates 3 transcript variants diverging at the presence/absence of two alternate exons. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) encodes the longest isoform (C). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218905 | FBXW11 (Myc-DDK-tagged)-Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 3 |
USD 757.00 |
|
RC218905L1 | Lenti ORF clone of Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 3, Myc-DDK-tagged |
USD 1,057.00 |
|
RC218905L2 | Lenti ORF clone of Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 3, mGFP tagged |
USD 1,057.00 |
|
RC218905L3 | Lenti ORF clone of Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 3, Myc-DDK-tagged |
USD 1,057.00 |
|
RC218905L4 | Lenti ORF clone of Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 3, mGFP tagged |
USD 1,057.00 |
|
RG218905 | FBXW11 (tGFP-tagged) - Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 3 |
USD 957.00 |
{0} Product Review(s)
Be the first one to submit a review