BIN1 (NM_139343) Human Untagged Clone

CAT#: SC310232

BIN1 (untagged)-Human bridging integrator 1 (BIN1), transcript variant 1

USD 948


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name BIN1 (NM_139343) Human Untagged Clone
Symbol BIN1
Synonyms AMPH2; AMPHL; SH3P9
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_139343 edited
GCGGCGTGGAGCGGCAGCCGGTCTGGACGCGCGGCCGGGGCTGGGGGCTGGGAGCGCGGC
GCGCAAGATCTCCCCGCGCGAGAGCGGCCCCTGCCACCGGGCGAGGCCTGCGCCGCGATG
GCAGAGATGGGCAGTAAAGGGGTGACGGCGGGAAAGATCGCCAGCAACGTGCAGAAGAAG
CTCACCCGCGCGCAGGAGAAGGTTCTCCAGAAGCTGGGGAAGGCAGATGAGACCAAGGAT
GAGCAGTTTGAGCAGTGCGTCCAGAATTTCAACAAGCAGCTGACGGAGGGCACCCGGCTG
CAGAAGGATCTCCGGACCTACCTGGCCTCCGTCAAAGCCATGCACGAGGCTTCCAAGAAG
CTGAATGAGTGTCTGCAGGAGGTGTATGAGCCCGATTGGCCCGGCAGGGATGAGGCAAAC
AAGATCGCAGAGAACAACGACCTGCTGTGGATGGATTACCACCAGAAGCTGGTGGACCAG
GCGCTGCTGACCATGGACACGTACCTGGGCCAGTTCCCCGACATCAAGTCACGCATTGCC
AAGCGGGGGCGCAAGCTGGTGGACTACGACAGTGCCCGGCACCACTACGAGTCCCTTCAA
ACCGCCAAAAAGAAGGATGAAGCCAAAATTGCCAAGCCTGTCTCGCTGCTTGAGAAAGCC
GCCCCCCAGTGGTGCCAAGGCAAACTGCAGGCTCATCTCGTAGCTCAAACTAACCTGCTC
CGAAATCAGGCCGAGGAGGAGCTCATCAAAGCCCAGAAGGTGTTTGAGGAGATGAATGTG
GATCTGCAGGAGGAGCTGCCGTCCCTGTGGAACAGCCGCGTAGGTTTCTACGTCAACACG
TTCCAGAGCATCGCGGGCCTGGAGGAAAACTTCCACAAGGAGATGAGCAAGCTCAACCAG
AACCTCAATGATGTGCTGGTCGGCCTGGAGAAGCAACACGGGAGCAACACCTTCACGGTC
AAGGCCCAGCCCAGTGACAACGCGCCTGCAAAAGGGAACAAGAGCCCTTCGCCTCCAGAT
GGCTCCCCTGCCGCCACCCCCGAGATCAGAGTCAACCACGAGCCAGAGCCGGCTGGCGGG
GCCACGCCCGGGGCCACCCTCCCCAAGTCCCCATCTCAGCTCCGGAAAGGCCCACCAGTC
CCTCCGCCTCCCAAACACACCCCGTCCAAGGAAGTCAAGCAGGAGCAGATCCTCAGCCTG
TTTGAGGACACGTTTGTCCCTGAGATCAGCGTGACCACCCCCTCCCAGTTTGAGGCCCCG
GGGCCTTTCTCGGAGCAGGCCAGTCTGCTGGACCTGGACTTTGACCCCCTCCCGCCCGTG
ACGAGCCCTGTGAAGGCACCCACGCCCTCTGGTCAGTCAATTCCTTGGGACCTCTGGGAG
CCCACAGAGAGTCCAGCCGGCAGCCTGCCTTCCGGGGAGCCCAGCGCTGCCGAGGGCACC
TTTGCTGTGTCCTGGCCCAGCCAGACGGCCGAGCCGGGGCCTGCCCAACCAGCAGAGGCC
TCGGAGGTGGCGGGTGGGACCCAACCTGCGGCTGGAGCCCAGGAGCCAGGGGAGACGGCG
GCAAGTGAAGCAGCCTCCAGCTCTCTTCCTGCTGTCGTGGTGGAGACCTTCCCAGCAACT
GTGAATGGCACCGTGGAGGGCGGCAGTGGGGCCGGGCGCTTGGACCTGCCCCCAGGTTTC
ATGTTCAAGGTACAGGCCCAGCACGACTACACGGCCACTGACACAGACGAGCTGCAGCTC
AAGGCTGGTGATGTGGTGCTGGTGATCCCCTTCCAGAACCCTGAAGAGCAGGATGAAGGC
TGGCTCATGGGCGTGAAGGAGAGCGACTGGAACCAGCACAAGGAGCTGGAGAAGTGCCGT
GGCGTCTTCCCCGAGAACTTCACTGAGAGGGTCCCATGACGGCGGGGCCCAGGCAGCCTC
CGGGCGTGTGAAGAACACCTCCTCCCGAAAAATGTGTGGTTCTTTTTTTTGTTTTGTTTT
CGTTTTTCATCTTTTGAAGAGCAAAGGGAAATCAAGAGGAGACCCCCAGGCAGAGGGGCG
TTCTCCCAAAGATTAGGTCGTTTTCCAAAGAGCCGCGTCCCGGCAAGTCCGGCGGAATTC
ACCAGTGTTCCTGAAGCTGCTGTGTCCTCTAGTTGAGTTTCTGGCGCCCCTGCCTGTGCC
CGCATGTGTGCCTGGCCGCAGGGCGGGGCTGGGGGCTGCCGAGCCACCATGCTTGCCTGA
AGCTTCGGCCGCGCCACCCGGGCAAGGGTCCTCTTTTCCTGGCAGCTGCTGTGGGTGGGG
CCCAGACACCAGCCTAGCCTGGCTCTGCCCCGCAGACGGTCTGTGTGCTGTTTGAAAATA
AATCTTAGTGTTCAAAACAAAATGAAACAAAAAAAAAA
Tag Tag Free
ACCN NM_139343
ORF Size 1782 bp
Insert Size 2400
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_139343.1, NP_647593
RefSeq Size 2637
RefSeq ORF 1782
Locus ID 274
Cytogenetics 2q14.3
Gene Summary This gene encodes several isoforms of a nucleocytoplasmic adaptor protein, one of which was initially identified as a MYC-interacting protein with features of a tumor suppressor. Isoforms that are expressed in the central nervous system may be involved in synaptic vesicle endocytosis and may interact with dynamin, synaptojanin, endophilin, and clathrin. Isoforms that are expressed in muscle and ubiquitously expressed isoforms localize to the cytoplasm and nucleus and activate a caspase-independent apoptotic process. Studies in mouse suggest that this gene plays an important role in cardiac muscle development. Alternate splicing of the gene results in several transcript variants encoding different isoforms. Aberrant splice variants expressed in tumor cell lines have also been described. [provided by RefSeq, Mar 2016].
Transcript Variant: This variant (1) encodes the longest isoform, which is cytoplasmic. Isoform 1, also called IIa and S11R3-a, binds dynamin, synaptojanin, and clathrin. This isoform is expressed exclusively in the brain and is concentrated in nerve terminals.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations