Caspase 8(CASP8) (NM_001228) Human Untagged Clone

CAT#: SC309754

CASP8 (untagged)-Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant A

USD 794


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Caspase 8(CASP8) (NM_001228) Human Untagged Clone
Symbol CASP8
Synonyms ALPS2B; CAP4; Casp-8; FLICE; MACH; MCH5
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001228 edited
CTGGTTGTTCAGACTGAGCTTCCTGCCTGCCTGTACCCCGCCAACAGCTTCAGAAGAAGG
TGACTGGTGGCTGCCTGAGGAATACCAGTGGGCAAGAGAATTAGCATTTCTGGAGCATCT
GCTGTCTGAGCAGCCCCTGGGTGCGTCCACTTTCTGGGCACGTGAGGTTGGGCCTTGGCC
GCCTGAGCCCTTGAGTTGGTCACTTGAACCTTGGGAATATTGAGATTATATTCTCCTGCC
TTTTAAAAAGATGGACTTCAGCAGAAATCTTTATGATATTGGGGAACAACTGGACAGTGA
AGATCTGGCCTCCCTCAAGTTCCTGAGCCTGGACTACATTCCGCAAAGGAAGCAAGAACC
CATCAAGGATGCCTTGATGTTATTCCAGAGACTCCAGGAAAAGAGAATGTTGGAGGAAAG
CAATCTGTCCTTCCTGAAGGAGCTGCTCTTCCGAATTAATAGACTGGATTTGCTGATTAC
CTACCTAAACACTAGAAAGGAGGAGATGGAAAGGGAACTTCAGACACCAGGCAGGGCTCA
AATTTCTGCCTACAGGTTCCACTTCTGCCGCATGAGCTGGGCTGAAGCAAACAGCCAGTG
CCAGACACAGTCTGTACCTTTCTGGCGGAGGGTCGATCATCTATTAATAAGGGTCATGCT
CTATCAAATTTCAGAAGAAGTGAGCAGATCAGAATTGAGGTCTTTTAAGTTTCTTTTGCA
AGAGGAAATCTCCAAATGCAAACTGGATGATGACATGAACCTGCTGGATATTTTCATAGA
GATGGAGAAGAGGGTCATCCTGGGAGAAGGAAAGTTGGACATCCTGAAAAGAGTCTGTGC
CCAAATCAACAAGAGCCTGCTGAAGATAATCAACGACTATGAAGAATTCAGCAAAGGGGA
GGAGTTGTGTGGGGTAATGACAATCTCGGACTCTCCAAGAGAACAGGATAGTGAATCACA
GACTTTGGACAAAGTTTACCAAATGAAAAGCAAACCTCGGGGATACTGTCTGATCATCAA
CAATCACAATTTTGCAAAAGCACGGGAGAAAGTGCCCAAACTTCACAGCATTAGGGACAG
GAATGGAACACACTTGGATGCAGGGGCTTTGACCACGACCTTTGAAGAGCTTCATTTTGA
GATCAAGCCCCACGATGACTGCACAGTAGAGCAAATCTATGAGATTTTGAAAATCTACCA
ACTCATGGACCACAGTAACATGGACTGCTTCATCTGCTGTATCCTCTCCCATGGAGACAA
GGGCATCATCTATGGCACTGATGGACAGGAGGCCCCCATCTATGAGCTGACATCTCAGTT
CACTGGTTTGAAGTGCCCTTCCCTTGCTGGAAAACCCAAAGTGTTTTTTATTCAGGCTTG
TCAGGGGGATAACTACCAGAAAGGTATACCTGTTGAGACTGATTCAGAGGAGCAACCCTA
TTTAGAAATGGATTTATCATCACCTCAAACGAGATATATCCCGGATGAGGCTGACTTTCT
GCTGGGGATGGCCACTGTGAATAACTGTGTTTCCTACCGAAACCCTGCAGAGGGAACCTG
GTACATCCAGTCACTTTGCCAGAGCCTGAGAGAGCGATGTCCTCGAGGCGATGATATTCT
CACCATCCTGACTGAAGTGAACTATGAAGTAAGCAACAAGGATGACAAGAAAAACATGGG
GAAACAGATGCCTCAGCCTACTTTCACACTAAGAAAAAAACTTGTCTTCCCTTCTGATTG
ATGGTGCTATTTTGTTTGTTTTGTTTTGTTTTGTTTTTTTGAGACAGAATCTCGCTCTGT
CGCCCAGGCTGGAGTGCAGTGGCGTGATCTCGGCTCACCGCAAGCTCCGCCTCCCGGGTG
GCATCCCTGTGACCCCTCCCCAGTGC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001228 unedited
GGGGAGGTCAAAATTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGCTGGT
TGTTCAGACTGAGCTTCCTGCCTGCCTGTACCCCGCCAACAGCTTCAGAAGAAGGTGACT
GGTGGCTGCCTGAGGAATACCAGTGGGCAAGAGAATTAGCATTTCTGGAGCATCTGCTGT
CTGAGCAGCCCCTGGGTGCGTCCACTTTCTGGGCACGTGAGGTTGGGCCTTGGCCGCCTG
AGCCCTTGAGTTGGTCACTTGAACCTTGGGAATATTGAGATTATATTCTCCTGCCTTTTA
AAAAGATGGACTTCAGCAGAAATCTTTATGATATTGGGGAACAACTGGACAGTGAAGATC
TGGCCTCCCTCAAGTTCCTGAGCCTGGACTACATTCCGCAAAGGAAGCAAGAACCCATCA
AGGATGCCTTGATGTTATTCCAGAGACTCCAGGAAAAGAGAATGTTGGAGGAAAGCAATC
TGTCCTTCCTGAAGGAGCTGCTCTTCCGAATTAATAGACTGGATTTGCTGATTACCTACC
TAAACACTAGAAAGGAGGAGATGGAAAGGGAACTTCAGACACCAGGCAGGGCTCAAATTT
CTGCCTACAGGTTCCACTTCTGCCGCATGAGCTGGGCTGAAGCAAACAGCCAGTGCCAGA
CACAGTCTGTACCTTTCTGGCGGAGGGTCGATCATCTATTAATAAGGGTCATGCTCTATC
AAATTTCAGAAGAAGTGAGCAGATCAGAATTGANGTCTTTTTAAGTTTCTTTTGNNCAGA
GAAATCTCCAAATGCAAACTGGATGATGACATGAACCTGCTGGATATTTTCATAGAGATG
GNANAAGAGGGTCATCCCTGGAGAAGGAAAGTTGGACATNCTGAAAANAGTCTGTGCCCC
AAATCAACAGAC
3' Read Nucleotide Sequence
>Forward primer walk for NM_001228 unedited
NAACATGGTGCAGGGCTTTGACACGACCTTTGAGAGCTTCATTTGAGATCAGCCCCACAT
GACTGCACAGTAGAGCAAATCTATGAGATTTTGAAAATCTACCAACTCATGGACCACAGT
AACATGGACTGCTTCATCTGCTGTATCCTCTCCCATGGAGACAAGGGCATCATCTATGGC
ACTGATGGACAGGAGGCCCCCATCTATGAGCTGACATCTCAGTTCACTGGTTTGAAGTGC
CCTTCCCTTGCTGGAAAACCCAAAGTGTTTTTTATTCAGGCTTGTCAGGGGGATAACTAC
CAGAAAGGTATACCTGTTGAGACTGATTCAGAGGAGCAACCCTATTTAGAAATGGATTTA
TCATCACCTCAAACGAGATATATCCCGGATGAGGCTGACTTTCTGCTGGGGATGGCCACT
GTGAATAACTGTGTTTCCTACCGAAACCCTGCAGAGGGAACCTGGTACATCCAGTCACTT
TGCCAGAGCCTGAGAGAGCGATGTCCTCGAGGCGATGATATTCTCACCATCCTGACTGAA
GTGAACTATGAAGTAAGCAACAAGGATGACAAGAAAAACATGGGGAAACAGATGCCTCAG
CCTACTTTCACACTAAGAAAAAAACTTGTCTTCCCTTCTGATTGATGGTGCTATTTTGTT
TGTTTTGTTTTGTTTTGTTTTTTTGAGACAGAATCTCGCTCTGTCGCCCAGGCTGGAGTG
CAGTGGCGTGATCTCGGCTCACCGCAAGCTCCGCCTCCCCGGTGGCATCCCTGTGACCCC
TCCCCATGCCTCTTCTGGCCCCTGGAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAA
TAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATATATATGGGT
Tag Tag Free
ACCN NM_001228
ORF Size 1491 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001228.3, NP_001219
RefSeq Size 2894
RefSeq ORF 1491
Locus ID 841
Cytogenetics 2q33.1
Domains DED, CASc, ICE_p10, ICE_p20
Protein Families Protease, Druggable Genome
Protein Pathways p53 signaling pathway, Apoptosis, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, Alzheimer's disease, Huntington's disease, Pathways in cancer, Viral myocarditis
Gene Summary This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain, a large protease subunit, and a small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This protein is involved in the programmed cell death induced by Fas and various apoptotic stimuli. The N-terminal FADD-like death effector domain of this protein suggests that it may interact with Fas-interacting protein FADD. This protein was detected in the insoluble fraction of the affected brain region from Huntington disease patients but not in those from normal controls, which implicated the role in neurodegenerative diseases. Many alternatively spliced transcript variants encoding different isoforms have been described, although not all variants have had their full-length sequences determined. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (A), also known as Alpha-4, has multiple differences in the 5' UTR and coding region, compared to variant G. It encodes isoform A which is shorter than isoform G.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.