NM23A (NME1) (NM_198175) Human Untagged Clone
SKU
SC309527
NME1 (untagged)-Human non-metastatic cells 1, protein (NM23A) expressed in (NME1), transcript variant 1
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | NM23A |
Synonyms | AWD; GAAD; NB; NBS; NDKA; NDPK-A; NDPKA; NM23; NM23-H1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_198175 edited
ACATTTTTAGGGTGTATTTCTGGCGCTTTAGTCCTGTTTTCTCCTGGACAATTTATGCTT GCCCCGCACCCCATCGTGCGATTCTCCGCAGTCTTTGGGCTTTGTCTCTCTCTCTTTTTT TTTTTTTGGAAGTTGCAGAATGGTGATAAATGATTTTCTTTGCTCCTATTGACTGCTAGG CCCTGTGGCTAGGTACCATAGAGTCTCTACACAGGAGTAAATCAGCCTGGTGTGCAGGGG AGGCAGACACACAAACAGAAAATTGGACTACAGTGCTAAGATGCTGTAAGAAGAGGTTAA CTAAAGGACAGGAAGATGGGGCCAAGAGATGGTGCTACTGTCTACTTTAGGGATCGTCTT TCAAGGCGAGGGGCCTCCTATCTCAAGCTGTGATACAGGAACCATGGCCAACTGTGAGCG TACCTTCATTGCGATCAAACCAGATGGGGTCCAGCGGGGTCTTGTGGGAGAGATTATCAA GCGTTTTGAGCAGAAAGGATTCCGCCTTGTTGGTCTGAAATTCATGCAAGCTTCCGAAGA TCTTCTCAAGGAACACTACGTTGACCTGAAGGACCGTCCATTCTTTGCCGGCCTGGTGAA ATACATGCACTCAGGGCCGGTAGTTGCCATGGTCTGGGAGGGGCTGAATGTGGTGAAGAC GGGCCGAGTCATGCTCGGGGAGACCAACCCTGCAGACTCCAAGCCTGGGACCATCCGTGG AGACTTCTGCATACAAGTTGGCAGGAACATTATACATGGCAGTGATTCTGTGGAGAGTGC AGAGAAGGAGATCGGCTTGTGGTTTCACCCTGAGGAACTGGTAGATTACACGAGCTGTGC TCAGAACTGGATCTATGAATGACAGGAGGGCAGACCACATTGCTTTTCACATCCATTTCC CCTCCTTCCCATGGGCAGAGGACCAGGCTGTAGGAAATCTAGTTATTTACAGGAACTTCA TCATAATTTGGAGGGAAGCTCTTGGAGCTGTGAGTTCTCCCTGTACAGTGTTACCATCCC CGACCATCTGATTAAAATGCTTCCTCCCAGCAAAAAAAAAAAAAAAAAA |
Restriction Sites | NotI-NotI |
ACCN | NM_198175 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone was fully sequenced and found to be a perfect match to NM_198175.1. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_198175.1, NP_937818.1 |
RefSeq Size | 1031 bp |
RefSeq ORF | 534 bp |
Locus ID | 4830 |
UniProt ID | P15531 |
Cytogenetics | 17q21.33 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Protein Pathways | Metabolic pathways, Purine metabolism, Pyrimidine metabolism |
Summary | This gene (NME1) was identified because of its reduced mRNA transcript levels in highly metastatic cells. Nucleoside diphosphate kinase (NDK) exists as a hexamer composed of 'A' (encoded by this gene) and 'B' (encoded by NME2) isoforms. Mutations in this gene have been identified in aggressive neuroblastomas. Two transcript variants encoding different isoforms have been found for this gene. Co-transcription of this gene and the neighboring downstream gene (NME2) generates naturally-occurring transcripts (NME1-NME2), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC220517 | NME1 (Myc-DDK-tagged)-Human non-metastatic cells 1, protein (NM23A) expressed in (NME1), transcript variant 1 | 10 ug |
$300.00
|
|
RC220517L1 | Lenti ORF clone of Human non-metastatic cells 1, protein (NM23A) expressed in (NME1), transcript variant 1, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC220517L2 | Lenti ORF clone of Human non-metastatic cells 1, protein (NM23A) expressed in (NME1), transcript variant 1, mGFP tagged | 10 ug |
$600.00
|
|
RC220517L3 | Lenti ORF clone of Human non-metastatic cells 1, protein (NM23A) expressed in (NME1), transcript variant 1, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC220517L4 | Lenti ORF clone of Human non-metastatic cells 1, protein (NM23A) expressed in (NME1), transcript variant 1, mGFP tagged | 10 ug |
$600.00
|
|
RG220517 | NME1 (tGFP-tagged) - Human non-metastatic cells 1, protein (NM23A) expressed in (NME1), transcript variant 1 | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.