HLAG (HLA-G) (NM_002127) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | HLAG |
Synonyms | MHC-G |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_002127 edited
ATGGTGGTCATGGCGCCCCGAACCCTCTTCCTGCTGCTCTCGGGGGCCCTGACCCTGACC GAGACCTGGGCGGGCTCCCACTCCATGAGGTATTTCAGCGCCGCCGTGTCCCGGCCCGGC CGCGGGGAGCCCCGCTTCATCGCCATGGGCTACGTGGACGACACGCAGTTCGTGCGGTTC GACAGCGACTCGGCGTGTCCGAGGATGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGG CCGGAGTATTGGGAAGAGGAGACACGGAACACCAAGGCCCACGCACAGACTGACAGAATG AACCTGCAGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCAGTTCTCACACCCTCCAG TGGATGATTGGCTGCGACCTGGGGTCCGACGGACGCCTCCTCCGCGGGTATGAACAGTAT GCCTACGATGGCAAGGATTACCTCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCAGCG GACACTGCGGCTCAGATCTCCAAGCGCAAGTGTGAGGCGGCCAATGTGGCTGAACAAAGG AGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCACAGATACCTGGAGAACGGGAAG GAGATGCTGCAGCGCGCGGACCCCCCCAAGACACACGTGACCCACCACCCTGTCTTTGAC TATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCATACTGACC TGGCAGCGGGATGGGGAGGACCAGACCCAGGACGTGGAGCTCGTGGAGACCAGGCCTGCA GGGGATGGAACCTTCCAGAAGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGA TACACGTGCCATGTGCAGCATGAGGGGCTGCCGGAGCCCCTCATGCTGAGATGGAAGCAG TCTTCCCTGCCCACCATCCCCATCATGGGTATCGTTGCTGGCCTGGTTGTCCTTGCAGCT GTAGTCACTGGAGCTGCGGTCGCTGCTGTGCTGTGGAGAAAGAAGAGCTCAGATTGA |
Restriction Sites | Please inquire |
ACCN | NM_002127 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_002127.3, NP_002118.1 |
RefSeq Size | 1840 bp |
RefSeq ORF | 1017 bp |
Locus ID | 3135 |
UniProt ID | P17693 |
Cytogenetics | 6p22.1 |
Protein Families | Transmembrane |
Protein Pathways | Allograft rejection, Antigen processing and presentation, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Endocytosis, Graft-versus-host disease, Natural killer cell mediated cytotoxicity, Type I diabetes mellitus, Viral myocarditis |
Summary | HLA-G belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. HLA-G is expressed on fetal derived placental cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exon 6 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC205216 | HLA (Myc-DDK-tagged)-Human major histocompatibility complex, class I, G (HLA-G) | 10 ug |
$686.00
|
|
RC205216L1 | Lenti ORF clone of Human major histocompatibility complex, class I, G (HLA-G), Myc-DDK-tagged | 10 ug |
$986.00
|
|
RC205216L2 | Lenti ORF clone of Human major histocompatibility complex, class I, G (HLA-G), mGFP tagged | 10 ug |
$986.00
|
|
RC205216L3 | Lenti ORF clone of Human major histocompatibility complex, class I, G (HLA-G), Myc-DDK-tagged | 10 ug |
$986.00
|
|
RC205216L4 | Lenti ORF clone of Human major histocompatibility complex, class I, G (HLA-G), mGFP tagged | 10 ug |
$986.00
|
|
RG205216 | HLA (tGFP-tagged) - Human major histocompatibility complex, class I, G (HLA-G) | 10 ug |
$489.00
MSRP
$886.00
MSRP
$886.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.