HLA-DRB1 (NM_002124) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | HLA-DRB1 |
Synonyms | DRB1; HLA-DR1B; HLA-DRB; SS1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_002124 edited
CTTGCCTGCTTCTCTGGCCCCTGGTCCTGTCCTGTTCTCCAGCATGGTGTGTCTGAAGCT CCCTGGAGGCTCCTGCATGACAGCGCTGACAGTGACACTGATGGTGCTGAGCTCCCCACT GGCTTTGTCTGGGGACACCCGACCACGTTTCCTGTGGCAGCCTAAGAGGGAGTGTCATTT CTTCAATGGGACGGAGCGGGTGCGGTTCCTGGACAGATACTTCTATAACCAGGAGGAGTC CGTGCGCTTCGACAGCGACGTGGGGGAGTTCCGGGCGGTGACGGAGCTGGGGCGGCCTGA CGCTGAGTACTGGAACAGCCAGAAGGACATCCTGGAGCAGGCGCGGGCCGCGGTGGACAC CTACTGCAGACACAACTACGGGGTTGTGGAGAGCTTCACAGTGCAGCGGCGAGTCCAACC TAAGGTGACTGTATATCCTTCAAAGACCCAGCCCCTGCAGCACCACAACCTCCTGGTCTG CTCTGTGAGTGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCTGAACGGCCAGGA AGAGAAGGCTGGGATGGTGTCCACAGGCCTGATCCAGAATGGAGACTGGACCTTCCAGAC CCTGGTGATGCTGGAAACAGTTCCTCGAAGTGGAGAGGTTTACACCTGCCAAGTGGAGCA CCCAAGCGTGACAAGCCCTCTCACAGTGGAATGGAGAGCACGGTCTGAATCTGCACAGAG CAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCT GTTCATCTACTTCAGGAATCAGAAAGGACACTCTGGACTTCAGCCAACAGGATTCCTGAG CTGAAATGCAGATGACCACATTCAAGGAAGAACTTTCTGCCCCGGCTTTGCAGGATGAAA AGCTTTCCTGCTTGGCAGTTATTCTTCCACAAGAGAGGGCTTTCTCAGGACCTGGTTGCT ACTGGTTCGGCAACTGCAGAAAATGTCCTCCCTTGTGGCTTCCTCAGCTCCTGCCCTTGG CCTGAAGTCCCAGCATTGATGGCAGCGCCTCATCTTCAACTTTTGTGCTCCCCTTTGCCT AAACCGTATGGCCTCCCGTGCATCTGTATTCACCCTGTATGACAAACACATTACATTATT AAATGTTTCTCAAAGATGGAGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002124 |
Insert Size | 1200 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002124.1. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_002124.1, NP_002115.1 |
RefSeq Size | 1182 bp |
RefSeq ORF | 801 bp |
Locus ID | 3123 |
UniProt ID | P04229 |
Cytogenetics | 6p21.32 |
Domains | ig, IGc1, MHC_II_beta |
Protein Families | Transmembrane |
Protein Pathways | Allograft rejection, Antigen processing and presentation, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Hematopoietic cell lineage, Systemic lupus erythematosus, Type I diabetes mellitus, Viral myocarditis |
Summary | HLA-DRB1 belongs to the HLA class II beta chain paralogs. The class II molecule is a heterodimer consisting of an alpha (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells. The beta chain is approximately 26-28 kDa. It is encoded by 6 exons. Exon one encodes the leader peptide; exons 2 and 3 encode the two extracellular domains; exon 4 encodes the transmembrane domain; and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Hundreds of DRB1 alleles have been described and some alleles have increased frequencies associated with certain diseases or conditions. For example, DRB1*1302 has been related to acute and chronic hepatitis B virus persistence. There are multiple pseudogenes of this gene. [provided by RefSeq, Jul 2020] Transcript Variant: This variant (1) represents the DRB1*15:01:01 allele of the HLA-DRB1 gene, as represented in the assembled chromosome 6 in the primary assembly of the reference genome and the CHM1_1.1 genome. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC218764 | HLA (Myc-DDK-tagged)-Human major histocompatibility complex, class II, DR beta 1 (HLA-DRB1) | 10 ug |
$450.00
|
|
RC218764L1 | Lenti ORF clone of Human major histocompatibility complex, class II, DR beta 1 (HLA-DRB1), Myc-DDK-tagged | 10 ug |
$750.00
|
|
RC218764L2 | Lenti ORF clone of Human major histocompatibility complex, class II, DR beta 1 (HLA-DRB1), mGFP tagged | 10 ug |
$750.00
|
|
RC218764L3 | Lenti ORF clone of Human major histocompatibility complex, class II, DR beta 1 (HLA-DRB1), Myc-DDK-tagged | 10 ug |
$750.00
|
|
RC218764L4 | Lenti ORF clone of Human major histocompatibility complex, class II, DR beta 1 (HLA-DRB1), mGFP tagged | 10 ug |
$750.00
|
|
RG218764 | HLA (tGFP-tagged) - Human major histocompatibility complex, class II, DR beta 1 (HLA-DRB1) | 10 ug |
$650.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.