LASS6 (CERS6) (NM_203463) Human Untagged Clone

SKU
SC308195
CERS6 (untagged)-Human LAG1 homolog, ceramide synthase 6 (LASS6)
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LASS6
Synonyms CERS5; LASS6
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>SC308195 representing NM_203463.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGGGATCTTAGCCTGGTTCTGGAACGAGAGGTTTTGGCTCCCGCACAATGTCACCTGGGCGGAC
CTGAAGAACACGGAGGAGGCCACCTTCCCGCAGGCTGAGGACCTCTATCTCGCTTTTCCCCTGGCCTTC
TGTATCTTCATGGTGCGGCTCATCTTCGAGAGATTTGTAGCCAAACCGTGCGCCATAGCCCTCAACATT
CAGGCCAATGGACCACAAATTGCTCCGCCCAATGCCATTCTGGAAAAGGTCTTCACTGCAATTACAAAG
CATCCTGATGAAAAGAGATTGGAAGGCCTCTCCAAGCAACTGGACTGGGATGTTCGAAGCATTCAGCGC
TGGTTTCGACAAAGACGCAATCAGGAGAAGCCAAGCACGCTGACGAGGTTCTGTGAGAGCATGTGGAGA
TTTTCATTTTACCTTTATGTATTTACCTACGGAGTCAGATTCCTGAAAAAGACCCCCTGGTTGTGGAAT
ACGAGGCATTGCTGGTACAACTACCCCTATCAGCCACTCACAACTGACCTTCACTACTATTACATCCTG
GAGCTGTCGTTTTATTGGTCTTTGATGTTTTCTCAGTTCACTGATATCAAAAGAAAGGACTTTGGCATT
ATGTTCCTGCACCACCTTGTATCTATTTTCTTGATTACCTTTTCATATGTCAACAATATGGCCCGAGTA
GGAACGCTGGTCCTTTGTCTTCATGATTCAGCTGATGCTCTTCTGGAGGCTGCCAAAATGGCAAATTAT
GCCAAGTTTCAGAAAATGTGTGATCTCCTGTTTGTTATGTTTGCCGTGGTTTTTATCACCACACGACTG
GGTATATTTCCTCTCTGGGTGTTAAATACCACATTATTTGAAAGCTGGGAGATCGTTGGACCTTACCCT
TCCTGGTGGGTTTTTAACCTACTGCTATTGCTAGTACAAGGGTTGAACTGCTTCTGGTCTTACTTGATT
GTGAAAATAGCTTGCAAAGCTGTTTCAAGAGGCAAGGTGTCCAAGGATGATCGAAGTGATATTGAGTCT
AGCTCAGATGAGGAGGACTCAGAACCTCCGGGAAAGAATCCCCACACTGCGACAACCACCAATGGGACC
AGTGGTACCAACGGGTATCTCCTGACTGGCTCCTGCTCCATGGATGATTAA

Restriction Sites NotI-NotI
ACCN NM_203463
Insert Size 1155 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_203463.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_203463.1
RefSeq Size 6259 bp
RefSeq ORF 1155 bp
Locus ID 253782
UniProt ID Q6ZMG9
Cytogenetics 2q24.3
Protein Families Druggable Genome, Transmembrane
MW 44.9 kDa
Summary May be involved in sphingolipid synthesis or its regulation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:LASS6 (CERS6) (NM_203463) Human Untagged Clone
Your Rating
SKU Description Size Price
RC219555 CERS6 (Myc-DDK-tagged)-Human LAG1 homolog, ceramide synthase 6 (LASS6) 10 ug
$457.00
RC219555L3 Lenti ORF clone of Human LAG1 homolog, ceramide synthase 6 (LASS6), Myc-DDK-tagged 10 ug
$757.00
RC219555L4 Lenti ORF clone of Human LAG1 homolog, ceramide synthase 6 (LASS6), mGFP tagged 10 ug
$757.00
RG219555 CERS6 (tGFP-tagged) - Human LAG1 homolog, ceramide synthase 6 (LASS6) 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.