GDNF (NM_199234) Human Untagged Clone

CAT#: SC307906

GDNF (untagged)-Human glial cell derived neurotrophic factor (GDNF), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GDNF
• Synonyms: astrocyte-derived trophic factor; ATF1; ATF2; glial cell derived neurotrophic factor; glial cell line derived neurotrophic factor; glial derived neurotrophic factor; HFB1-GDNF
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_199234 edited
  ATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGCGTCCGCCTTC
  CCGCTGCCAACCCAGAGAATTCCAGAGGAAAAGGTCGGAGAGGCCAGAGGGGCAAAAACC
  GGGGTTGTGTCTTAACTGCAATACATTTAAATGTCACTGACTTGGGTCTGGGCTATGAAA
  CCAAGGAGGAACTGATTTTTAGGTACTGCAGCGGCTCTTGCGATGCAGCTGAGACAACGT
  ACGACAAAATATTGAAAAACTTATCCAGAAATAGAAGGCTGGTGAGTGACAAAGTAGGGC
  AGGCATGTTGCAGACCCATCGCCTTTGATGATGACCTGTCGTTTTTAGATGATAACCTGG
  TTTACCATATTCTAAGAAAGCATTCCGCTAAAAGGTGTGGATGTATCTGA
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_199234 unedited
  GGGTTTGCATTTGTATACCACTCCTATAGGGCGGCCGCGATTCCTGCAGCCCGGGGGATC
  CGCCCATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGCGTCCG
  CCTTCCCGCTGCCAACCCAGAGAATTCCAGAGGAAAAGGTCGGAGAGGCCAGAGGGGCAA
  AAACCGGGGTTGTGTCTTAACTGCAATACATTTAAATGTCACTGACTTGGGTCTGGGCTA
  TGAAACCAAGGAGGAACTGATTTTTAGGTACTGCAGCGGCTCTTGCGATGCAGCTGAGAC
  AACGTACGACAAAATATTGAAAAACTTATCCAGAAATAGAAGGCTGGTGAGTGACAAAGT
  AGGGCAGGCATGTTGCAGACCCATCGCCTTTGATGATGACCTGTCGTTTTTAGATGATAA
  CCTGGTTTACCATATTCTAAGAAAGCATTCCGCTAAAAGGTGTGGATGTATCTGAGGGCT
  AGAGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCC
  TCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTA
  ATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGG
  AGGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTNAGGCCTGCGGGGT
  CTATTGGGAACCAAGCTGGAGTGCAGTGGCACCATCTTGGCTCACTGCAATCTCCGCCTC
  CTGGGTTCAAGCGATTCTCCTGCCTTAGCCTCCCCGATTGTTGGGATTCCAGGCATGCCT
  GACCCGGCTCAACTAATTTTTGGTTTTTTGGTAAAAACGGGGTTTACCCTTTTTGGCCAG
  
• Restriction Sites: Please inquire
• ACCN: NM_199234
• Insert Size: 600 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_199234.1, NP_954704.1
• RefSeq Size: 410 bp
• RefSeq ORF: 402 bp
• Locus ID: 2668
• Cytogenetics: 5p13.2
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Gene Summary: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Mutations in this gene may be associated with Hirschsprung disease and Tourette syndrome. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
  Transcript Variant: This variant (3) lacks an alternate segment in the 5' UTR and uses a downstream start codon, compared to variant 1. Isoform 3 has a shorter and distinct N-terminus, compared to isoform 1.