IL1RA (IL1RN) (NM_173842) Human Untagged Clone

CAT#: SC306939

IL1RN (untagged)-Human interleukin 1 receptor antagonist (IL1RN), transcript variant 1


  "NM_173842" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
IL1RN mouse monoclonal antibody, clone OTI2B1 (formerly 2B1)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "IL1RA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IL1RA
Synonyms DIRA; ICIL-1RA; IL-1ra; IL-1ra3; IL-1RN; IL1F3; IL1RA; IRAP; MVCD4
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_173842 edited
ATGGAAATCTGCAGAGGCCTCCGCAGTCACCTAATCACTCTCCTCCTCTTCCTGTTCCAT
TCAGAGACGATCTGCCGACCCTCTGGGAGAAAATCCAGCAAGATGCAAGCCTTCAGAATC
TGGGATGTTAACCAGAAGACCTTCTATCTGAGGAACAACCAACTAGTTGCCGGATACTTG
CAAGGACCAAATGTCAATTTAGAAGAAAAGATAGATGTGGTACCCATTGAGCCTCATGCT
CTGTTCTTGGGAATCCATGGAGGGAAGATGTGCCTGTCCTGTGTCAAGTCTGGTGATGAG
ACCAGACTCCAGCTGGAGGCAGTTAACATCACTGACCTGAGCGAGAACAGAAAGCAGGAC
AAGCGCTTCGCCTTCATCCGCTCAGACAGTGGCCCCACCACCAGTTTTGAGTCTGCCGCC
TGCCCCGGTTGGTTCCTCTGCACAGCGATGGAAGCTGACCAGCCCGTCAGCCTCACCAAT
ATGCCTGACGAAGGCGTCATGGTCACCAAATTCTACTTCCAGGAGGACGAGTAG
>OriGene 5' read for NM_173842 unedited
TTGTNACGTCGTTTTTTGTATACGACTCCTATAGGCGGCCGCGNAATTCTGGNAAATCTG
CAGAGGCCTCCGCAGTCACCTAATCACTCTCCTCCTCTTCCTGTTCCATTCAGAGACGAT
CTGCCGACCCTCTGGGAGAAAATCCAGCAAGATGCAAGCCTTCAGAATCTGGGATGTTAA
CCAGAAGACCTTCTATCTGAGGAACAACCAACTAGTTGCCGGATACTTGCAAGGACCAAA
TGTCAATTTAGAAGAAAAGATAGATGTGGTACCCATTGAGCCTCATGCTCTGTTCTTGGG
AATCCATGGAGGGAAGATGTGCCTGTCCTGTGTCAAGTCTGGTGATGAGACCAGACTCCA
GCTGGAGGCAGTTAACATCACTGACCTGAGCGAGAACAGAAAGCAGGACAAGCGCTTCGC
CTTCATCCGCTCAGACAGTGGCCCCACCACCAGTTTTGAGTCTGCCGCCTGCCCCGGTTG
GTTCCTCTGCACAGCGATGGAAGCTGACCAGCCCGTCAGCCTCACCAATATGCCTGACGA
AGGCGTCATGGTCACCAAATTCTACTTCCAGGAGGACGAGTAGTACTGCCCAGGCCTGCC
TGTTCCCATTCTTGCATGGCAAGGACTGCAGGNACTGCCAGTCCCCCTGCCCCAGGGCTC
CCGGCTATGGGGGCACTNGAGACCAGCCATTGAGGGGTGGACCCTCAGAAGGCGTCACAA
CAACCTGGTCACAGGACTCTGCCTTCTCTTCACTGACCAGCCTCCATGCTGCCTNCAGAA
TGGTCTTTCTAATGTGTGAAATCAGAACACAGGAGCCCCTGCACCAAGCCCTTCCATGTC
CGCCCCTGCTTTCAGGGATCAAACCCCGACCACCT
Restriction Sites Please inquire     
ACCN NM_173842
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_173842.1, NP_776214.1
RefSeq Size 1760 bp
RefSeq ORF 534 bp
Locus ID 3557
UniProt ID P18510
Cytogenetics 2q14.1
Protein Families Druggable Genome, Secreted Protein
Gene Summary The protein encoded by this gene is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses, particularly in the acute phase of infection and inflammation. This gene and five other closely related cytokine genes form a gene cluster spanning approximately 400 kb on chromosome 2. A polymorphism of this gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Aug 2020]
Transcript Variant: This variant (1) differs in the 5' end compared to variant 2, resulting in an isoform (1) that has a distinct and shorter N-terminus, as compared to the longest isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.