IL21 (NM_021803) Human Untagged Clone

CAT#: SC304958

IL21 (untagged)-Human interleukin 21 (IL21), transcript variant 1

USD 402


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name IL21 (NM_021803) Human Untagged Clone
Symbol IL21
Synonyms CVID11; IL-21; Za11
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_021803 edited
GCCACCATGAGATCCAGTCCTGGCAACATGGAGAGGATTGTCATCTGTCTGATGGTCATC
TTCTTGGGGACACTGGTCCACAAATCAAGCTCCCAAGGTCAAGATCGCCACATGATTAGA
ATGCGTCAACTTATAGATATTGTTGATCAGCTGAAAAATTATGTGAATGACTTGGTCCCT
GAATTTCTGCCAGCTCCAGAAGATGTAGAGACAAACTGTGAGTGGTCAGCTTTTTCCTGC
TTTCAGAAGGCCCAACTAAAGTCAGCAAATACAGGAAACAATGAAAGGATAATCAATGTA
TCAATTAAAAAGCTGAAGAGGAAACCACCTTCCACAAATGCAGGGAGAAGACAGAAACAC
AGACTAACATGCCCTTCATGTGATTCTTATGAGAAAAAACCACCCAAAGAATTCCTAGAA
AGATTCAAATCACTTCTCCAAAAGATGATTCATCAGCATCTGTCCTCTAGAACACACGGA
AGTGAAGATTCCTGA
Tag Tag Free
ACCN NM_021803
ORF Size 489 bp
Insert Size 500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_021803.1, NP_068575
RefSeq Size 642
RefSeq ORF 489
Locus ID 59067
Cytogenetics 4q27
Protein Families Secreted Protein, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
Gene Summary This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011].
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.