MAVS (NM_020746) Human Untagged Clone

SKU
SC304815
MAVS (untagged)-Human mitochondrial antiviral signaling protein (MAVS), nuclear gene encoding mitochondrial protein, transcript variant 1
$755.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MAVS
Synonyms CARDIF; IPS-1; IPS1; VISA
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_020746 edited
ATGCCGTTTGCTGAAGACAAGACCTATAAGTATATCTGCCGCAATTTCAGCAATTTTTGC
AATGTGGATGTTGTAGAGATTCTGCCTTACCTGCCCTGCCTCACAGCAAGAGACCAGGAT
CGACTGCGGGCCACCTGCACACTCTCAGGGAACCGGGACACCCTCTGGCATCTCTTCAAT
ACCCTTCAGCGGCGGCCCGGCTGGGTGGAGTACTTCATTGCGGCACTGAGGGGCTGTGAG
CTAGTTGATCTCGCGGACGAAGTGGCCTCTGTCTACCAGAGCTACCAGCCTCGGACCTCG
GACCGTCCCCCAGACCCACTGGAGCCACCGTCACTTCCTGCTGAGAGGCCAGGGCCCCCC
ACACCTGCTGCGGCCCACAGCATCCCCTACAACAGCTGCAGAGAGAAGGAGCCAAGTTAC
CCCATGCCTGTCCAGGAGACCCAGGCGCCAGAGTCCCCAGGAGAGAATTCAGAGCAAGCC
CTGCAGACGCTCAGCCCCAGAGCCATCCCAAGGAATCCAGATGGTGGCCCCCTGGAGTCC
TCCTCTGACCTGGCAGCCCTCAGCCCTCTGACCTCCAGCGGGCATCAGGAGCAGGACACA
GAACTGGGCAGTACCCACACAGCAGGTGCGACCTCCAGCCTCACACCATCCCGTGGGCCT
GTGTCTCCATCTGTCTCCTTCCAGCCCCTGGCCCGTTCCACCCCCAGGGCAAGCCGCTTG
CCTGGACCCACAGGGTCAGTTGTATCTACTGGCACCTCCTTCTCCTCCTCATCCCCTGGC
TTGGCCTCTGCAGGGGCTGCAGAGGGTAAACAGGGTGCAGAGAGTGACCAGGCCGAGCCT
ATCATCTGCTCCAGTGGGGCAGAGGCACCTGCCAACTCTCTGCCCTCCAAAGTGCCTACC
ACCTTGATGCCTGTGAACACAGTGGCCCTGAAAGTGCCTGCCAACCCAGCATCTGTCAGC
ACAGTGCCCTCCAAGTTGCCAACTAGCTCAAAGCCCCCTGGTGCAGTGCCTTCTAATGCG
CTCACCAATCCAGCACCATCCAAATTGCCCATCAACTCAACCCGTGCTGGCATGGTGCCA
TCCAAAGTGCCTACTAGCATGGTGCTCACCAAGGTGTCTGCCAGCACAGTCCCCACTGAC
GGGAGCAGCAGAAATGAGGAGACCCCAGCAGCTCCAACACCCGCCGGCGCCACTGGAGGC
AGCTCAGCCTGGCTAGACAGCAGCTCTGAGAATAGGGGCCTTGGGTCGGAGCTGAGTAAG
CCTGGCGTGCTGGCATCCCAGGTAGACAGCCCGTTCTCGGGCTGCTTCGAGGATCTTGCC
ATCAGTGCCAGCACCTCCTTGGGCATGGGGCCCTGCCATGGCCCAGAGGAGAATGAGTAT
AAGTCCGAGGGCACCTTTGGGATCCACGTGGCTGAGAACCCCAGCATCCAGCTCCTGGAG
GGCAACCCTGGGCCACCTGCGGACCCGGATGGCGGCCCCAGGCCACAAGCCGACCGGAAG
TTCCAGGAGAGGGAGGTGCCATGCCACAGGCCCTCACCTGGGGCTCTGTGGCTCCAGGTG
GCTGTGACAGGGGTGCTGGTAGTCACACTCCTGGTGGTGCTGTACCGGCGGCGTCTGCAC
TAG
Restriction Sites Please inquire
ACCN NM_020746
Insert Size 4100 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_020746.2, NP_065797.2
RefSeq Size 2936 bp
RefSeq ORF 1623 bp
Locus ID 57506
UniProt ID Q7Z434
Cytogenetics 20p13
Protein Families Transmembrane
Protein Pathways Cytosolic DNA-sensing pathway, RIG-I-like receptor signaling pathway
Summary This gene encodes an intermediary protein necessary in the virus-triggered beta interferon signaling pathways. It is required for activation of transcription factors which regulate expression of beta interferon and contributes to antiviral innate immunity. [provided by RefSeq, Jul 2020]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
Write Your Own Review
You're reviewing:MAVS (NM_020746) Human Untagged Clone
Your Rating
SKU Description Size Price
RC208175 MAVS (Myc-DDK-tagged)-Human mitochondrial antiviral signaling protein (MAVS), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$754.00
RC208175L1 Lenti ORF clone of Human mitochondrial antiviral signaling protein (MAVS), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$1,054.00
RC208175L2 Lenti ORF clone of Human mitochondrial antiviral signaling protein (MAVS), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$1,054.00
RC208175L3 Lenti ORF clone of Human mitochondrial antiviral signaling protein (MAVS), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$1,054.00
RC208175L4 Lenti ORF clone of Human mitochondrial antiviral signaling protein (MAVS), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$1,054.00
RG208175 MAVS (tGFP-tagged) - Human mitochondrial antiviral signaling protein (MAVS), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$954.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.