SLAMF8 (NM_020125) Human Untagged Clone

CAT#: SC304709

SLAMF8 (untagged)-Human SLAM family member 8 (SLAMF8)


  "NM_020125" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-SLAMF8 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SLAMF8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLAMF8
Synonyms BLAME; CD353; SBBI42
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_020125 edited
GAGTTTGCCTGCCTCTCCAGAGAAAGATGGTCATGAGGCCCCTGTGGAGTCTGCTTCTCT
GGGAAGCCCTACTTCCCATTACAGTTACTGGTGCCCAAGTGCTGAGCAAAGTCGGGGGCT
CGGTGCTGCTGGTGGCAGCGCGTCCCCCTGGCTTCCAAGTCCGTGAGGCTATCTGGCGAT
CTCTCTGGCCTTCAGAAGAGCTCCTGGCCACGTTTTTCCGAGGCTCCCTGGAGACTCTGT
ACCATTCCCGCTTCCTGGGCCGAGCCCAGCTACACAGCAACATCAGCCTGGAGCTCGGGC
CGCTGGAGTCTGGAGACAGCGGCAACTTCTCCGTGTTGATGGTGGACACAAGGGGCCAGC
CCTGGACCCAGACCCTCCAGCTCAAGGTGTACGATGCAGTGCCCAGGCCCGTGGTACAAG
TGTTCATTGCTGTAGAAAGGGATGCTCAGCCCTCCAAGACCTGCCAGGTTTTCTTGTCCT
GTTGGGCCCCCAACATCAGCGAAATAACCTATAGCTGGCGACGGGAGACAACCATGGACT
TTGGTATGGAACCACACAGCCTCTTCACAGACGGACAGGTGCTGAGCATTTCCCTGGGAC
CAGGAGACAGAGATGTGGCCTATTCCTGCATTGTCTCCAACCCTGTCAGCTGGGACTTGG
CCACAGTCACGCCCTGGGATAGCTGTCATCATGAGGCAGCACCAGGGAAGGCCTCCTACA
AAGATGTGCTGCTGGTGGTGGTGCCTGTCTCGCTGCTCCTGATGCTGGTTACTCTCTTCT
CTGCCTGGCACTGGTGCCCCTGCTCAGGGAAAAAGAAAAAGGATGTCCATGCTGACAGAG
TGGGTCCAGAGACAGAGAACCCCCTTGTGCAGGATCTGCCATAAAGGACAATATGAACTG
ATGCCTGGACTATCAGTAACCCCACTGCACAGGCACACGATGCTCTGGGACATAACTGGT
GCCTGGAAATCACCATGGTCCTCATATCTCCCATGGGAATCCTGTCCTGCCTCGAAGGAG
CAGCCTGGGCAGCCATCACACCACGAGGACAGGAAGCACCAGCACGTTTCACACCTCCCC
CTTCCCTCTCCCATCTTCTCATATCCTGGCTCTTCTCTGGGCAAGATGAGCCAAGCAGA
Restriction Sites Please inquire     
ACCN NM_020125
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_020125.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_020125.1, NP_064510.1
RefSeq Size 3197 bp
RefSeq ORF 858 bp
Locus ID 56833
UniProt ID Q9P0V8
Cytogenetics 1q23.2
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a member of the CD2 family of cell surface proteins involved in lymphocyte activation. These proteins are characterized by Ig domains. This protein is expressed in lymphoid tissues, and studies of a similar protein in mouse suggest that it may function during B cell lineage commitment. The gene is found in a region of chromosome 1 containing many CD2 genes. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.